Incidental Mutation 'R5245:Flt4'
ID401116
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission 042816-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5245 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AC to ACC at 49651034 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect probably null
Transcript: ENSMUST00000020617
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,684,260 Y270* probably null Het
Akap9 A T 5: 3,976,209 Q59L probably damaging Het
Aloxe3 A T 11: 69,129,676 Q182L probably benign Het
Arhgef5 G T 6: 43,265,680 probably benign Het
Bcas3 T A 11: 85,559,086 N663K probably damaging Het
Cntfr A T 4: 41,670,879 W95R possibly damaging Het
Dcun1d4 A G 5: 73,557,314 T275A probably benign Het
Eps8l1 A G 7: 4,470,874 R227G probably damaging Het
Ets2 G A 16: 95,712,260 W160* probably null Het
Fam46a G T 9: 85,326,348 Q160K possibly damaging Het
Fsip2 A G 2: 82,993,161 M6413V probably benign Het
Gm14401 C T 2: 177,086,678 P186S probably damaging Het
Hrc G A 7: 45,335,431 G2D probably damaging Het
Kcnq3 A G 15: 66,031,435 V142A possibly damaging Het
Lama3 G A 18: 12,419,893 C454Y probably damaging Het
Lrrk2 A G 15: 91,796,089 T2068A probably damaging Het
Mab21l2 T C 3: 86,547,492 E67G possibly damaging Het
Map3k5 G A 10: 20,140,691 V1343I probably benign Het
Mcm4 T A 16: 15,630,425 T423S probably benign Het
Mmp16 A G 4: 18,054,596 probably benign Het
Nat3 C T 8: 67,548,180 T237I probably benign Het
Nol4 A T 18: 22,695,122 *484R probably null Het
Nsmf A G 2: 25,056,107 E202G probably damaging Het
Olfml2b T C 1: 170,668,874 V358A probably benign Het
Olfr1396 T A 11: 49,113,289 I146F probably benign Het
Olfr32 T A 2: 90,138,262 K292N probably damaging Het
Osbpl1a T C 18: 12,758,853 E466G probably damaging Het
Pifo T C 3: 106,014,454 H51R possibly damaging Het
Pim3 A G 15: 88,863,201 E90G possibly damaging Het
Recql5 T C 11: 115,893,559 E905G probably damaging Het
Rnf31 T G 14: 55,601,706 L925R probably damaging Het
Secisbp2l A G 2: 125,747,591 V679A probably damaging Het
Setdb2 T A 14: 59,426,494 E68V probably null Het
Shtn1 T A 19: 59,032,220 N190I possibly damaging Het
Slc25a25 G A 2: 32,421,328 Q14* probably null Het
Snrnp27 A G 6: 86,682,959 S18P unknown Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tbx5 T C 5: 119,883,165 V412A possibly damaging Het
Tcea3 A G 4: 136,264,502 T166A probably benign Het
Tdrp A T 8: 13,974,479 probably benign Het
Tmem132e T C 11: 82,442,638 V624A probably damaging Het
Tnnt1 T C 7: 4,510,067 D72G probably damaging Het
Trim80 C A 11: 115,441,572 H197N probably damaging Het
Zfp322a A T 13: 23,356,986 C195* probably null Het
Zfp335 A G 2: 164,894,758 S986P probably benign Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1401:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2218:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4168:Flt4 UTSW 11 49630573 missense probably benign 0.01
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4701:Flt4 UTSW 11 49626808 missense possibly damaging 0.49
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4817:Flt4 UTSW 11 49625415 missense probably damaging 0.98
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5066:Flt4 UTSW 11 49634163 missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5527:Flt4 UTSW 11 49634754 missense probably damaging 1.00
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5766:Flt4 UTSW 11 49626686 missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6352:Flt4 UTSW 11 49643506 missense probably benign 0.04
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R6574:Flt4 UTSW 11 49625372 missense probably benign
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
R7457:Flt4 UTSW 11 49630328 missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49644371 missense possibly damaging 0.50
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AACACTATGCTCCGTGTCTTGG -3'
(R):5'- TACAGAGTTCAAGGGAGCCC -3'

Sequencing Primer
(F):5'- CTTGGCAGCTGTAAAGGTCC -3'
(R):5'- ACTCTTCCTGGATATGGAGGC -3'
Posted On2016-07-06