Mutagenetix > Incidental Mutation

Incidental Mutation 'R5245:Trim80'

401120

Institutional Source

Beutler Lab

Gene Symbol

Trim80

Ensembl Gene

ENSMUSG00000070332

Gene Name

tripartite motif-containing 80

Synonyms

4933422H20Rik

MMRRC Submission

042816-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R5245 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115440545-115448270 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 115441572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 197 (H197N)

Ref Sequence

ENSEMBL: ENSMUSP00000091442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093914]

AlphaFold

Q3V061

Predicted Effect

probably damaging
Transcript: ENSMUST00000093914
AA Change: H197N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091442
Gene: ENSMUSG00000070332
AA Change: H197N

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
RING	71	114	4.48e-7	SMART
Blast:BBOX	154	202	7e-22	BLAST
Pfam:zf-B_box	207	246	2.2e-10	PFAM
Blast:PRY	441	496	2e-18	BLAST
Pfam:SPRY	499	621	3.9e-12	PFAM

Meta Mutation Damage Score

0.4309

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd17b	T	A	19: 21,684,260	Y270*	probably null	Het
Akap9	A	T	5: 3,976,209	Q59L	probably damaging	Het
Aloxe3	A	T	11: 69,129,676	Q182L	probably benign	Het
Arhgef5	G	T	6: 43,265,680		probably benign	Het
Bcas3	T	A	11: 85,559,086	N663K	probably damaging	Het
Cntfr	A	T	4: 41,670,879	W95R	possibly damaging	Het
Dcun1d4	A	G	5: 73,557,314	T275A	probably benign	Het
Eps8l1	A	G	7: 4,470,874	R227G	probably damaging	Het
Ets2	G	A	16: 95,712,260	W160*	probably null	Het
Fam46a	G	T	9: 85,326,348	Q160K	possibly damaging	Het
Flt4	AC	ACC	11: 49,651,034		probably null	Het
Fsip2	A	G	2: 82,993,161	M6413V	probably benign	Het
Gm14401	C	T	2: 177,086,678	P186S	probably damaging	Het
Hrc	G	A	7: 45,335,431	G2D	probably damaging	Het
Kcnq3	A	G	15: 66,031,435	V142A	possibly damaging	Het
Lama3	G	A	18: 12,419,893	C454Y	probably damaging	Het
Lrrk2	A	G	15: 91,796,089	T2068A	probably damaging	Het
Mab21l2	T	C	3: 86,547,492	E67G	possibly damaging	Het
Map3k5	G	A	10: 20,140,691	V1343I	probably benign	Het
Mcm4	T	A	16: 15,630,425	T423S	probably benign	Het
Mmp16	A	G	4: 18,054,596		probably benign	Het
Nat3	C	T	8: 67,548,180	T237I	probably benign	Het
Nol4	A	T	18: 22,695,122	*484R	probably null	Het
Nsmf	A	G	2: 25,056,107	E202G	probably damaging	Het
Olfml2b	T	C	1: 170,668,874	V358A	probably benign	Het
Olfr1396	T	A	11: 49,113,289	I146F	probably benign	Het
Olfr32	T	A	2: 90,138,262	K292N	probably damaging	Het
Osbpl1a	T	C	18: 12,758,853	E466G	probably damaging	Het
Pifo	T	C	3: 106,014,454	H51R	possibly damaging	Het
Pim3	A	G	15: 88,863,201	E90G	possibly damaging	Het
Recql5	T	C	11: 115,893,559	E905G	probably damaging	Het
Rnf31	T	G	14: 55,601,706	L925R	probably damaging	Het
Secisbp2l	A	G	2: 125,747,591	V679A	probably damaging	Het
Setdb2	T	A	14: 59,426,494	E68V	probably null	Het
Shtn1	T	A	19: 59,032,220	N190I	possibly damaging	Het
Slc25a25	G	A	2: 32,421,328	Q14*	probably null	Het
Snrnp27	A	G	6: 86,682,959	S18P	unknown	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Tbx5	T	C	5: 119,883,165	V412A	possibly damaging	Het
Tcea3	A	G	4: 136,264,502	T166A	probably benign	Het
Tdrp	A	T	8: 13,974,479		probably benign	Het
Tmem132e	T	C	11: 82,442,638	V624A	probably damaging	Het
Tnnt1	T	C	7: 4,510,067	D72G	probably damaging	Het
Zfp322a	A	T	13: 23,356,986	C195*	probably null	Het
Zfp335	A	G	2: 164,894,758	S986P	probably benign	Het

Other mutations in Trim80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Trim80	APN	11	115447665	missense	probably benign	0.21
IGL00921:Trim80	APN	11	115447664	missense	probably benign	0.00
IGL02948:Trim80	APN	11	115441593	missense	possibly damaging	0.81
IGL03037:Trim80	APN	11	115441593	missense	possibly damaging	0.81
R0019:Trim80	UTSW	11	115447942	missense	probably damaging	1.00
R0019:Trim80	UTSW	11	115447942	missense	probably damaging	1.00
R0409:Trim80	UTSW	11	115441213	missense	probably damaging	1.00
R1069:Trim80	UTSW	11	115448083	missense	probably damaging	1.00
R1832:Trim80	UTSW	11	115446793	missense	probably benign
R1952:Trim80	UTSW	11	115441329	nonsense	probably null
R2892:Trim80	UTSW	11	115448023	missense	possibly damaging	0.81
R4301:Trim80	UTSW	11	115445113	critical splice donor site	probably null
R4748:Trim80	UTSW	11	115448138	missense	possibly damaging	0.84
R4795:Trim80	UTSW	11	115447943	missense	probably damaging	1.00
R4819:Trim80	UTSW	11	115447943	missense	probably damaging	1.00
R4910:Trim80	UTSW	11	115446455	missense	probably damaging	0.99
R5288:Trim80	UTSW	11	115448017	missense	probably benign	0.07
R5384:Trim80	UTSW	11	115448017	missense	probably benign	0.07
R5386:Trim80	UTSW	11	115448017	missense	probably benign	0.07
R5508:Trim80	UTSW	11	115445078	missense	probably benign	0.06
R5645:Trim80	UTSW	11	115446785	missense	probably damaging	1.00
R5785:Trim80	UTSW	11	115446475	nonsense	probably null
R5822:Trim80	UTSW	11	115447921	missense	probably damaging	0.99
R6754:Trim80	UTSW	11	115448174	missense	probably damaging	1.00
R6785:Trim80	UTSW	11	115441201	missense	probably damaging	0.99
R6788:Trim80	UTSW	11	115448017	missense	probably benign	0.07
R7336:Trim80	UTSW	11	115441216	missense	probably damaging	1.00
R8316:Trim80	UTSW	11	115441180	missense	probably damaging	1.00
R8386:Trim80	UTSW	11	115445074	missense	probably damaging	0.99
R8955:Trim80	UTSW	11	115440712	missense	probably benign
R9764:Trim80	UTSW	11	115447931	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- AGATGGTGGCTTGCTTCAC -3'
(R):5'- ACAGATTCTCAGAGCCTGGAG -3'

Sequencing Primer
(F):5'- TTGCTTCACCCAGGCCAAGAG -3'
(R):5'- GAGCACGCCCTTTCCTCAG -3'

Posted On

2016-07-06