Mutagenetix > Incidental Mutation

Incidental Mutation 'R5245:Setdb2'

401124

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

042816-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R5245 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59426494 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 68 (E68V)

Ref Sequence

ENSEMBL: ENSMUSP00000093450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably null
Transcript: ENSMUST00000095775
AA Change: E68V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: E68V

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111253
AA Change: E68V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160904

Predicted Effect

probably benign
Transcript: ENSMUST00000161459
AA Change: E68V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: E68V

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd17b	T	A	19: 21,684,260	Y270*	probably null	Het
Akap9	A	T	5: 3,976,209	Q59L	probably damaging	Het
Aloxe3	A	T	11: 69,129,676	Q182L	probably benign	Het
Arhgef5	G	T	6: 43,265,680		probably benign	Het
Bcas3	T	A	11: 85,559,086	N663K	probably damaging	Het
Cntfr	A	T	4: 41,670,879	W95R	possibly damaging	Het
Dcun1d4	A	G	5: 73,557,314	T275A	probably benign	Het
Eps8l1	A	G	7: 4,470,874	R227G	probably damaging	Het
Ets2	G	A	16: 95,712,260	W160*	probably null	Het
Fam46a	G	T	9: 85,326,348	Q160K	possibly damaging	Het
Flt4	AC	ACC	11: 49,651,034		probably null	Het
Fsip2	A	G	2: 82,993,161	M6413V	probably benign	Het
Gm14401	C	T	2: 177,086,678	P186S	probably damaging	Het
Hrc	G	A	7: 45,335,431	G2D	probably damaging	Het
Kcnq3	A	G	15: 66,031,435	V142A	possibly damaging	Het
Lama3	G	A	18: 12,419,893	C454Y	probably damaging	Het
Lrrk2	A	G	15: 91,796,089	T2068A	probably damaging	Het
Mab21l2	T	C	3: 86,547,492	E67G	possibly damaging	Het
Map3k5	G	A	10: 20,140,691	V1343I	probably benign	Het
Mcm4	T	A	16: 15,630,425	T423S	probably benign	Het
Mmp16	A	G	4: 18,054,596		probably benign	Het
Nat3	C	T	8: 67,548,180	T237I	probably benign	Het
Nol4	A	T	18: 22,695,122	*484R	probably null	Het
Nsmf	A	G	2: 25,056,107	E202G	probably damaging	Het
Olfml2b	T	C	1: 170,668,874	V358A	probably benign	Het
Olfr1396	T	A	11: 49,113,289	I146F	probably benign	Het
Olfr32	T	A	2: 90,138,262	K292N	probably damaging	Het
Osbpl1a	T	C	18: 12,758,853	E466G	probably damaging	Het
Pifo	T	C	3: 106,014,454	H51R	possibly damaging	Het
Pim3	A	G	15: 88,863,201	E90G	possibly damaging	Het
Recql5	T	C	11: 115,893,559	E905G	probably damaging	Het
Rnf31	T	G	14: 55,601,706	L925R	probably damaging	Het
Secisbp2l	A	G	2: 125,747,591	V679A	probably damaging	Het
Shtn1	T	A	19: 59,032,220	N190I	possibly damaging	Het
Slc25a25	G	A	2: 32,421,328	Q14*	probably null	Het
Snrnp27	A	G	6: 86,682,959	S18P	unknown	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Tbx5	T	C	5: 119,883,165	V412A	possibly damaging	Het
Tcea3	A	G	4: 136,264,502	T166A	probably benign	Het
Tdrp	A	T	8: 13,974,479		probably benign	Het
Tmem132e	T	C	11: 82,442,638	V624A	probably damaging	Het
Tnnt1	T	C	7: 4,510,067	D72G	probably damaging	Het
Trim80	C	A	11: 115,441,572	H197N	probably damaging	Het
Zfp322a	A	T	13: 23,356,986	C195*	probably null	Het
Zfp335	A	G	2: 164,894,758	S986P	probably benign	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R6971:Setdb2	UTSW	14	59415740	missense	probably damaging	1.00
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCATGGTGCTTTGTAGGA -3'
(R):5'- TGGTAACCTAAATGGAAGTGATGATG -3'

Sequencing Primer
(F):5'- AGGAGGGGGAGGACTTTTCATG -3'
(R):5'- CTCCTCTCCTCTCTCTCCCC -3'

Posted On

2016-07-06