Incidental Mutation 'R5245:Setdb2'
ID 401124
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene Name SET domain, bifurcated 2
Synonyms KMT1F, LOC239122
MMRRC Submission 042816-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R5245 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 59639458-59678329 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59663943 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 68 (E68V)
Ref Sequence ENSEMBL: ENSMUSP00000093450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]
AlphaFold Q8C267
Predicted Effect probably null
Transcript: ENSMUST00000095775
AA Change: E68V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: E68V

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111253
AA Change: E68V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160904
Predicted Effect probably benign
Transcript: ENSMUST00000161459
AA Change: E68V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: E68V

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b T A 19: 21,661,624 (GRCm39) Y270* probably null Het
Akap9 A T 5: 4,026,209 (GRCm39) Q59L probably damaging Het
Aloxe3 A T 11: 69,020,502 (GRCm39) Q182L probably benign Het
Arhgef5 G T 6: 43,242,614 (GRCm39) probably benign Het
Bcas3 T A 11: 85,449,912 (GRCm39) N663K probably damaging Het
Cimap3 T C 3: 105,921,770 (GRCm39) H51R possibly damaging Het
Cntfr A T 4: 41,670,879 (GRCm39) W95R possibly damaging Het
Dcun1d4 A G 5: 73,714,657 (GRCm39) T275A probably benign Het
Eps8l1 A G 7: 4,473,873 (GRCm39) R227G probably damaging Het
Ets2 G A 16: 95,513,304 (GRCm39) W160* probably null Het
Flt4 AC ACC 11: 49,541,861 (GRCm39) probably null Het
Fsip2 A G 2: 82,823,505 (GRCm39) M6413V probably benign Het
Gm14401 C T 2: 176,778,471 (GRCm39) P186S probably damaging Het
Hrc G A 7: 44,984,855 (GRCm39) G2D probably damaging Het
Kcnq3 A G 15: 65,903,284 (GRCm39) V142A possibly damaging Het
Lama3 G A 18: 12,552,950 (GRCm39) C454Y probably damaging Het
Lrrk2 A G 15: 91,680,292 (GRCm39) T2068A probably damaging Het
Mab21l2 T C 3: 86,454,799 (GRCm39) E67G possibly damaging Het
Map3k5 G A 10: 20,016,437 (GRCm39) V1343I probably benign Het
Mcm4 T A 16: 15,448,289 (GRCm39) T423S probably benign Het
Mmp16 A G 4: 18,054,596 (GRCm39) probably benign Het
Nat3 C T 8: 68,000,832 (GRCm39) T237I probably benign Het
Nol4 A T 18: 22,828,179 (GRCm39) *484R probably null Het
Nsmf A G 2: 24,946,119 (GRCm39) E202G probably damaging Het
Olfml2b T C 1: 170,496,443 (GRCm39) V358A probably benign Het
Or2v2 T A 11: 49,004,116 (GRCm39) I146F probably benign Het
Or4b1d T A 2: 89,968,606 (GRCm39) K292N probably damaging Het
Osbpl1a T C 18: 12,891,910 (GRCm39) E466G probably damaging Het
Pim3 A G 15: 88,747,404 (GRCm39) E90G possibly damaging Het
Recql5 T C 11: 115,784,385 (GRCm39) E905G probably damaging Het
Rnf31 T G 14: 55,839,163 (GRCm39) L925R probably damaging Het
Secisbp2l A G 2: 125,589,511 (GRCm39) V679A probably damaging Het
Shtn1 T A 19: 59,020,652 (GRCm39) N190I possibly damaging Het
Slc25a25 G A 2: 32,311,340 (GRCm39) Q14* probably null Het
Snrnp27 A G 6: 86,659,941 (GRCm39) S18P unknown Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Tbx5 T C 5: 120,021,230 (GRCm39) V412A possibly damaging Het
Tcea3 A G 4: 135,991,813 (GRCm39) T166A probably benign Het
Tdrp A T 8: 14,024,479 (GRCm39) probably benign Het
Tent5a G T 9: 85,208,401 (GRCm39) Q160K possibly damaging Het
Tmem132e T C 11: 82,333,464 (GRCm39) V624A probably damaging Het
Tnnt1 T C 7: 4,513,066 (GRCm39) D72G probably damaging Het
Trim80 C A 11: 115,332,398 (GRCm39) H197N probably damaging Het
Zfp322a A T 13: 23,541,156 (GRCm39) C195* probably null Het
Zfp335 A G 2: 164,736,678 (GRCm39) S986P probably benign Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59,653,241 (GRCm39) missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59,639,742 (GRCm39) utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59,660,885 (GRCm39) missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59,650,939 (GRCm39) missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59,668,607 (GRCm39) missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59,639,764 (GRCm39) missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59,644,193 (GRCm39) splice site probably null
R0610:Setdb2 UTSW 14 59,654,919 (GRCm39) missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59,644,153 (GRCm39) missense probably benign 0.40
R0890:Setdb2 UTSW 14 59,656,669 (GRCm39) missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59,660,945 (GRCm39) splice site probably benign
R1355:Setdb2 UTSW 14 59,654,890 (GRCm39) missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59,654,934 (GRCm39) missense probably benign 0.04
R1968:Setdb2 UTSW 14 59,656,858 (GRCm39) missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59,656,903 (GRCm39) missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59,663,916 (GRCm39) missense probably benign 0.00
R3919:Setdb2 UTSW 14 59,656,616 (GRCm39) missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59,653,153 (GRCm39) missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59,646,808 (GRCm39) missense probably benign 0.13
R4816:Setdb2 UTSW 14 59,651,095 (GRCm39) missense probably benign 0.05
R4864:Setdb2 UTSW 14 59,646,715 (GRCm39) missense probably benign 0.01
R4951:Setdb2 UTSW 14 59,639,752 (GRCm39) missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59,653,156 (GRCm39) missense probably damaging 0.99
R5358:Setdb2 UTSW 14 59,646,885 (GRCm39) missense probably benign 0.17
R5656:Setdb2 UTSW 14 59,656,567 (GRCm39) missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59,660,814 (GRCm39) missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59,646,981 (GRCm39) splice site probably null
R6106:Setdb2 UTSW 14 59,660,898 (GRCm39) nonsense probably null
R6388:Setdb2 UTSW 14 59,662,146 (GRCm39) missense probably benign
R6431:Setdb2 UTSW 14 59,656,505 (GRCm39) missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59,639,863 (GRCm39) missense probably benign 0.12
R6971:Setdb2 UTSW 14 59,653,189 (GRCm39) missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59,656,700 (GRCm39) missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59,660,794 (GRCm39) nonsense probably null
R7759:Setdb2 UTSW 14 59,656,813 (GRCm39) missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59,660,833 (GRCm39) nonsense probably null
R8039:Setdb2 UTSW 14 59,639,824 (GRCm39) missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59,651,141 (GRCm39) splice site probably benign
R8393:Setdb2 UTSW 14 59,650,180 (GRCm39) missense probably benign 0.04
R8513:Setdb2 UTSW 14 59,639,839 (GRCm39) missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59,654,888 (GRCm39) missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59,660,907 (GRCm39) nonsense probably null
R8940:Setdb2 UTSW 14 59,646,956 (GRCm39) missense probably damaging 1.00
R9217:Setdb2 UTSW 14 59,646,881 (GRCm39) missense possibly damaging 0.61
R9314:Setdb2 UTSW 14 59,650,240 (GRCm39) missense probably benign 0.02
R9336:Setdb2 UTSW 14 59,660,816 (GRCm39) missense unknown
R9442:Setdb2 UTSW 14 59,639,849 (GRCm39) missense probably damaging 1.00
R9525:Setdb2 UTSW 14 59,646,841 (GRCm39) missense probably benign 0.00
R9743:Setdb2 UTSW 14 59,651,002 (GRCm39) missense probably benign 0.00
X0017:Setdb2 UTSW 14 59,656,917 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATGGTGCTTTGTAGGA -3'
(R):5'- TGGTAACCTAAATGGAAGTGATGATG -3'

Sequencing Primer
(F):5'- AGGAGGGGGAGGACTTTTCATG -3'
(R):5'- CTCCTCTCCTCTCTCTCCCC -3'
Posted On 2016-07-06