Incidental Mutation 'R5247:Gm8251'
ID401171
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission 042818-MU
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5247 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 44057006 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1644 (L1644*)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect probably null
Transcript: ENSMUST00000168641
AA Change: L1644*
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: L1644*

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar A T 1: 72,680,184 V502E probably benign Het
Atad2 A T 15: 58,104,478 L585* probably null Het
Atp6v0a2 T C 5: 124,713,177 S475P probably damaging Het
BC067074 A T 13: 113,319,459 I680F probably damaging Het
Cacng1 T C 11: 107,716,279 H38R probably benign Het
Celsr2 A G 3: 108,397,630 V2168A probably benign Het
Cnot4 C T 6: 35,051,416 V422I probably damaging Het
Col1a1 T C 11: 94,947,187 probably null Het
Ctcfl A T 2: 173,113,609 C287S probably damaging Het
Eps8l1 T A 7: 4,470,402 D133E probably damaging Het
Fam161b A G 12: 84,357,750 L52P probably damaging Het
Fam98c T C 7: 29,155,701 E99G possibly damaging Het
Fmn2 A T 1: 174,821,228 I1574L probably benign Het
Gabrb3 T A 7: 57,590,591 L8Q possibly damaging Het
Gm21964 T C 8: 110,110,577 F299S probably damaging Het
Hck A T 2: 153,134,695 K250* probably null Het
Herc1 A G 9: 66,434,551 E1874G probably benign Het
Igf2 G T 7: 142,653,931 A143D possibly damaging Het
Isg20l2 A G 3: 87,931,613 N44D possibly damaging Het
Kdm7a T A 6: 39,144,456 Q855L probably benign Het
Kif15 T C 9: 122,986,442 S434P possibly damaging Het
Klrc3 A T 6: 129,641,462 N119K probably damaging Het
L3mbtl3 T C 10: 26,327,808 M375V unknown Het
Lpcat4 A G 2: 112,242,515 H173R possibly damaging Het
Mapk13 A T 17: 28,777,751 Q264L probably benign Het
Mrps18c C G 5: 100,798,793 C8W probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nlrp4b T A 7: 10,714,218 I116N probably benign Het
Olfr1489 T A 19: 13,633,414 F101Y probably damaging Het
Olfr239 A G 17: 33,199,530 T161A probably benign Het
Prdm1 A T 10: 44,440,102 H679Q probably damaging Het
Prickle2 T A 6: 92,375,969 S839C probably damaging Het
Rps19 T A 7: 24,885,453 S36T probably damaging Het
Serpinb1a T A 13: 32,850,406 M1L probably damaging Het
Slc16a7 A T 10: 125,231,314 M152K probably damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Stx18 A T 5: 38,106,633 Y141F probably damaging Het
Tgfb2 A T 1: 186,649,914 probably null Het
Tmem151b A T 17: 45,545,645 Y290N probably damaging Het
Ttn G A 2: 76,728,422 T29705M probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Usp19 T G 9: 108,496,065 probably null Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACCGTGTCAGTTGAAGTCTC -3'
(R):5'- GCAAGGGTTCAGGTTCAGTATG -3'

Sequencing Primer
(F):5'- CAGTATTTAGGGAGACATTCGTCCC -3'
(R):5'- GGCAGTAAGGAAAGTAGTACTCTTTC -3'
Posted On2016-07-06