Incidental Mutation 'R5247:Tgfb2'
ID 401175
Institutional Source Beutler Lab
Gene Symbol Tgfb2
Ensembl Gene ENSMUSG00000039239
Gene Name transforming growth factor, beta 2
Synonyms Tgfb-2, Tgf-beta2
MMRRC Submission 042818-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5247 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 186354989-186438186 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 186382111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045288] [ENSMUST00000045288] [ENSMUST00000195201] [ENSMUST00000195201]
AlphaFold P27090
Predicted Effect probably null
Transcript: ENSMUST00000045288
SMART Domains Protein: ENSMUSP00000043849
Gene: ENSMUSG00000039239

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 20 284 1.1e-38 PFAM
TGFB 317 414 1.25e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000045288
SMART Domains Protein: ENSMUSP00000043849
Gene: ENSMUSG00000039239

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 20 284 1.1e-38 PFAM
TGFB 317 414 1.25e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194960
Predicted Effect probably null
Transcript: ENSMUST00000195201
SMART Domains Protein: ENSMUSP00000142149
Gene: ENSMUSG00000039239

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 9 138 2.4e-9 PFAM
Pfam:TGFb_propeptide 152 311 1.4e-23 PFAM
TGFB 345 442 6.1e-40 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195201
SMART Domains Protein: ENSMUSP00000142149
Gene: ENSMUSG00000039239

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 9 138 2.4e-9 PFAM
Pfam:TGFb_propeptide 152 311 1.4e-23 PFAM
TGFB 345 442 6.1e-40 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Mice lacking a functional copy of this gene display developmental defects in multiple organs and perinatal lethality. Heterozygous mutant mice exhibit aortic root aneurysm. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lungs, skull, limbs, spinal column, eyes, inner ears, and urogenital system, and perinatal mortality. Heterozygotes show abnormalities of the Cowpers' gland and intestinal mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar A T 1: 72,719,343 (GRCm39) V502E probably benign Het
Atad2 A T 15: 57,967,874 (GRCm39) L585* probably null Het
Atp6v0a2 T C 5: 124,790,241 (GRCm39) S475P probably damaging Het
Cacng1 T C 11: 107,607,105 (GRCm39) H38R probably benign Het
Ccdc168 A C 1: 44,096,166 (GRCm39) L1644* probably null Het
Celsr2 A G 3: 108,304,946 (GRCm39) V2168A probably benign Het
Cnot4 C T 6: 35,028,351 (GRCm39) V422I probably damaging Het
Col1a1 T C 11: 94,838,013 (GRCm39) probably null Het
Cspg4b A T 13: 113,455,993 (GRCm39) I680F probably damaging Het
Ctcfl A T 2: 172,955,402 (GRCm39) C287S probably damaging Het
Eps8l1 T A 7: 4,473,401 (GRCm39) D133E probably damaging Het
Fam161b A G 12: 84,404,524 (GRCm39) L52P probably damaging Het
Fam98c T C 7: 28,855,126 (GRCm39) E99G possibly damaging Het
Fmn2 A T 1: 174,648,794 (GRCm39) I1574L probably benign Het
Gabrb3 T A 7: 57,240,339 (GRCm39) L8Q possibly damaging Het
Hck A T 2: 152,976,615 (GRCm39) K250* probably null Het
Herc1 A G 9: 66,341,833 (GRCm39) E1874G probably benign Het
Igf2 G T 7: 142,207,668 (GRCm39) A143D possibly damaging Het
Isg20l2 A G 3: 87,838,920 (GRCm39) N44D possibly damaging Het
Kdm7a T A 6: 39,121,390 (GRCm39) Q855L probably benign Het
Kif15 T C 9: 122,815,507 (GRCm39) S434P possibly damaging Het
Klrc3 A T 6: 129,618,425 (GRCm39) N119K probably damaging Het
L3mbtl3 T C 10: 26,203,706 (GRCm39) M375V unknown Het
Lpcat4 A G 2: 112,072,860 (GRCm39) H173R possibly damaging Het
Mapk13 A T 17: 28,996,725 (GRCm39) Q264L probably benign Het
Mrps18c C G 5: 100,946,659 (GRCm39) C8W probably damaging Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Nlrp4b T A 7: 10,448,145 (GRCm39) I116N probably benign Het
Or10h1 A G 17: 33,418,504 (GRCm39) T161A probably benign Het
Or5b124 T A 19: 13,610,778 (GRCm39) F101Y probably damaging Het
Prdm1 A T 10: 44,316,098 (GRCm39) H679Q probably damaging Het
Prickle2 T A 6: 92,352,950 (GRCm39) S839C probably damaging Het
Rps19 T A 7: 24,584,878 (GRCm39) S36T probably damaging Het
Serpinb1a T A 13: 33,034,389 (GRCm39) M1L probably damaging Het
Slc16a7 A T 10: 125,067,183 (GRCm39) M152K probably damaging Het
Srpk3 C T X: 72,818,555 (GRCm39) R82* probably null Het
Stx18 A T 5: 38,263,977 (GRCm39) Y141F probably damaging Het
Tle7 T C 8: 110,837,209 (GRCm39) F299S probably damaging Het
Tmem151b A T 17: 45,856,571 (GRCm39) Y290N probably damaging Het
Ttn G A 2: 76,558,766 (GRCm39) T29705M probably damaging Het
Tymp GC GCC 15: 89,258,567 (GRCm39) probably null Het
Usp19 T G 9: 108,373,264 (GRCm39) probably null Het
Other mutations in Tgfb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Tgfb2 APN 1 186,436,784 (GRCm39) missense probably benign 0.39
IGL01304:Tgfb2 APN 1 186,357,670 (GRCm39) missense probably damaging 0.99
IGL03028:Tgfb2 APN 1 186,362,806 (GRCm39) critical splice donor site probably null
PIT4486001:Tgfb2 UTSW 1 186,422,924 (GRCm39) missense probably benign 0.04
R2017:Tgfb2 UTSW 1 186,362,962 (GRCm39) nonsense probably null
R2880:Tgfb2 UTSW 1 186,436,752 (GRCm39) missense probably damaging 1.00
R4182:Tgfb2 UTSW 1 186,361,222 (GRCm39) missense possibly damaging 0.95
R4292:Tgfb2 UTSW 1 186,364,735 (GRCm39) missense probably damaging 1.00
R4478:Tgfb2 UTSW 1 186,364,696 (GRCm39) missense probably damaging 1.00
R4801:Tgfb2 UTSW 1 186,361,110 (GRCm39) nonsense probably null
R4802:Tgfb2 UTSW 1 186,361,110 (GRCm39) nonsense probably null
R5254:Tgfb2 UTSW 1 186,436,680 (GRCm39) missense probably damaging 1.00
R5614:Tgfb2 UTSW 1 186,357,710 (GRCm39) missense probably benign 0.21
R5988:Tgfb2 UTSW 1 186,436,778 (GRCm39) missense probably benign 0.05
R6898:Tgfb2 UTSW 1 186,364,697 (GRCm39) missense probably damaging 1.00
R6961:Tgfb2 UTSW 1 186,382,032 (GRCm39) missense possibly damaging 0.67
R7098:Tgfb2 UTSW 1 186,362,834 (GRCm39) missense probably damaging 1.00
R7346:Tgfb2 UTSW 1 186,382,077 (GRCm39) missense probably benign 0.00
R7729:Tgfb2 UTSW 1 186,362,954 (GRCm39) missense possibly damaging 0.94
R8167:Tgfb2 UTSW 1 186,422,942 (GRCm39) missense possibly damaging 0.94
R8825:Tgfb2 UTSW 1 186,361,136 (GRCm39) missense probably damaging 1.00
R8884:Tgfb2 UTSW 1 186,364,907 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTGTCTCACGCACTCC -3'
(R):5'- CTGCTTCTCCTGGAACCAAAC -3'

Sequencing Primer
(F):5'- AGGTTACCTGATACAGTTCAATCCGC -3'
(R):5'- CACACATGTTGATTTTAGTTTGTTCC -3'
Posted On 2016-07-06