Incidental Mutation 'R5247:Slc16a7'
ID 401201
Institutional Source Beutler Lab
Gene Symbol Slc16a7
Ensembl Gene ENSMUSG00000020102
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms 4921534N07Rik, MCT2
MMRRC Submission 042818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R5247 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 125219270-125389465 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125231314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 152 (M152K)
Ref Sequence ENSEMBL: ENSMUSP00000147968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781]
AlphaFold O70451
Predicted Effect probably damaging
Transcript: ENSMUST00000063318
AA Change: M152K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102
AA Change: M152K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 2e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105257
AA Change: M152K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102
AA Change: M152K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210780
AA Change: M152K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000211781
AA Change: M152K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar A T 1: 72,680,184 V502E probably benign Het
Atad2 A T 15: 58,104,478 L585* probably null Het
Atp6v0a2 T C 5: 124,713,177 S475P probably damaging Het
BC067074 A T 13: 113,319,459 I680F probably damaging Het
Cacng1 T C 11: 107,716,279 H38R probably benign Het
Celsr2 A G 3: 108,397,630 V2168A probably benign Het
Cnot4 C T 6: 35,051,416 V422I probably damaging Het
Col1a1 T C 11: 94,947,187 probably null Het
Ctcfl A T 2: 173,113,609 C287S probably damaging Het
Eps8l1 T A 7: 4,470,402 D133E probably damaging Het
Fam161b A G 12: 84,357,750 L52P probably damaging Het
Fam98c T C 7: 29,155,701 E99G possibly damaging Het
Fmn2 A T 1: 174,821,228 I1574L probably benign Het
Gabrb3 T A 7: 57,590,591 L8Q possibly damaging Het
Gm21964 T C 8: 110,110,577 F299S probably damaging Het
Gm8251 A C 1: 44,057,006 L1644* probably null Het
Hck A T 2: 153,134,695 K250* probably null Het
Herc1 A G 9: 66,434,551 E1874G probably benign Het
Igf2 G T 7: 142,653,931 A143D possibly damaging Het
Isg20l2 A G 3: 87,931,613 N44D possibly damaging Het
Kdm7a T A 6: 39,144,456 Q855L probably benign Het
Kif15 T C 9: 122,986,442 S434P possibly damaging Het
Klrc3 A T 6: 129,641,462 N119K probably damaging Het
L3mbtl3 T C 10: 26,327,808 M375V unknown Het
Lpcat4 A G 2: 112,242,515 H173R possibly damaging Het
Mapk13 A T 17: 28,777,751 Q264L probably benign Het
Mrps18c C G 5: 100,798,793 C8W probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nlrp4b T A 7: 10,714,218 I116N probably benign Het
Olfr1489 T A 19: 13,633,414 F101Y probably damaging Het
Olfr239 A G 17: 33,199,530 T161A probably benign Het
Prdm1 A T 10: 44,440,102 H679Q probably damaging Het
Prickle2 T A 6: 92,375,969 S839C probably damaging Het
Rps19 T A 7: 24,885,453 S36T probably damaging Het
Serpinb1a T A 13: 32,850,406 M1L probably damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Stx18 A T 5: 38,106,633 Y141F probably damaging Het
Tgfb2 A T 1: 186,649,914 probably null Het
Tmem151b A T 17: 45,545,645 Y290N probably damaging Het
Ttn G A 2: 76,728,422 T29705M probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Usp19 T G 9: 108,496,065 probably null Het
Other mutations in Slc16a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Slc16a7 APN 10 125230934 missense probably benign 0.16
IGL02228:Slc16a7 APN 10 125230798 missense probably damaging 1.00
IGL02500:Slc16a7 APN 10 125230933 missense probably damaging 1.00
IGL03277:Slc16a7 APN 10 125230691 missense probably benign 0.00
R0044:Slc16a7 UTSW 10 125228082 missense probably benign 0.01
R0076:Slc16a7 UTSW 10 125228070 missense probably benign 0.34
R0285:Slc16a7 UTSW 10 125294631 missense probably benign 0.22
R0546:Slc16a7 UTSW 10 125230873 missense probably benign 0.02
R0898:Slc16a7 UTSW 10 125233501 missense possibly damaging 0.46
R1123:Slc16a7 UTSW 10 125231147 missense probably benign 0.00
R1173:Slc16a7 UTSW 10 125231372 missense possibly damaging 0.82
R1459:Slc16a7 UTSW 10 125230620 nonsense probably null
R1554:Slc16a7 UTSW 10 125230922 missense possibly damaging 0.70
R1838:Slc16a7 UTSW 10 125231198 missense probably damaging 1.00
R3545:Slc16a7 UTSW 10 125294700 nonsense probably null
R3546:Slc16a7 UTSW 10 125294700 nonsense probably null
R3547:Slc16a7 UTSW 10 125294700 nonsense probably null
R3934:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R3935:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R4499:Slc16a7 UTSW 10 125228187 missense probably damaging 1.00
R4512:Slc16a7 UTSW 10 125233439 splice site probably null
R4513:Slc16a7 UTSW 10 125233439 splice site probably null
R4514:Slc16a7 UTSW 10 125233439 splice site probably null
R5157:Slc16a7 UTSW 10 125233464 nonsense probably null
R5385:Slc16a7 UTSW 10 125294604 missense possibly damaging 0.85
R6198:Slc16a7 UTSW 10 125228215 missense probably benign
R6263:Slc16a7 UTSW 10 125294639 missense probably benign 0.16
R6430:Slc16a7 UTSW 10 125231018 missense probably damaging 0.97
R7450:Slc16a7 UTSW 10 125228051 missense probably benign 0.00
R7680:Slc16a7 UTSW 10 125230936 missense probably benign 0.19
R8125:Slc16a7 UTSW 10 125328333 critical splice donor site probably null
R9133:Slc16a7 UTSW 10 125230667 missense probably benign 0.00
R9301:Slc16a7 UTSW 10 125231011 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGCCAACCTTACTTTTAGACTTC -3'
(R):5'- CACAATGTCCTGTTTAATGTCTGTC -3'

Sequencing Primer
(F):5'- CTTAGTATTTGGACTTGGCCCAACAG -3'
(R):5'- TGTCTGTCTTATCATCTATAGTGGAC -3'
Posted On 2016-07-06