Incidental Mutation 'R5247:Cacng1'
ID401203
Institutional Source Beutler Lab
Gene Symbol Cacng1
Ensembl Gene ENSMUSG00000020722
Gene Namecalcium channel, voltage-dependent, gamma subunit 1
Synonyms
MMRRC Submission 042818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5247 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location107703218-107716522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107716279 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 38 (H38R)
Ref Sequence ENSEMBL: ENSMUSP00000021065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021065]
Predicted Effect probably benign
Transcript: ENSMUST00000021065
AA Change: H38R

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021065
Gene: ENSMUSG00000020722
AA Change: H38R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 6 200 6.3e-12 PFAM
Pfam:Claudin_2 17 202 2.6e-41 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is part of skeletal muscle 1,4-dihydropyridine-sensitive calcium channels and is an integral membrane protein that plays a role in excitation-contraction coupling. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for null mutations display abnormal muscle calcium currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar A T 1: 72,680,184 V502E probably benign Het
Atad2 A T 15: 58,104,478 L585* probably null Het
Atp6v0a2 T C 5: 124,713,177 S475P probably damaging Het
BC067074 A T 13: 113,319,459 I680F probably damaging Het
Celsr2 A G 3: 108,397,630 V2168A probably benign Het
Cnot4 C T 6: 35,051,416 V422I probably damaging Het
Col1a1 T C 11: 94,947,187 probably null Het
Ctcfl A T 2: 173,113,609 C287S probably damaging Het
Eps8l1 T A 7: 4,470,402 D133E probably damaging Het
Fam161b A G 12: 84,357,750 L52P probably damaging Het
Fam98c T C 7: 29,155,701 E99G possibly damaging Het
Fmn2 A T 1: 174,821,228 I1574L probably benign Het
Gabrb3 T A 7: 57,590,591 L8Q possibly damaging Het
Gm21964 T C 8: 110,110,577 F299S probably damaging Het
Gm8251 A C 1: 44,057,006 L1644* probably null Het
Hck A T 2: 153,134,695 K250* probably null Het
Herc1 A G 9: 66,434,551 E1874G probably benign Het
Igf2 G T 7: 142,653,931 A143D possibly damaging Het
Isg20l2 A G 3: 87,931,613 N44D possibly damaging Het
Kdm7a T A 6: 39,144,456 Q855L probably benign Het
Kif15 T C 9: 122,986,442 S434P possibly damaging Het
Klrc3 A T 6: 129,641,462 N119K probably damaging Het
L3mbtl3 T C 10: 26,327,808 M375V unknown Het
Lpcat4 A G 2: 112,242,515 H173R possibly damaging Het
Mapk13 A T 17: 28,777,751 Q264L probably benign Het
Mrps18c C G 5: 100,798,793 C8W probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nlrp4b T A 7: 10,714,218 I116N probably benign Het
Olfr1489 T A 19: 13,633,414 F101Y probably damaging Het
Olfr239 A G 17: 33,199,530 T161A probably benign Het
Prdm1 A T 10: 44,440,102 H679Q probably damaging Het
Prickle2 T A 6: 92,375,969 S839C probably damaging Het
Rps19 T A 7: 24,885,453 S36T probably damaging Het
Serpinb1a T A 13: 32,850,406 M1L probably damaging Het
Slc16a7 A T 10: 125,231,314 M152K probably damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Stx18 A T 5: 38,106,633 Y141F probably damaging Het
Tgfb2 A T 1: 186,649,914 probably null Het
Tmem151b A T 17: 45,545,645 Y290N probably damaging Het
Ttn G A 2: 76,728,422 T29705M probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Usp19 T G 9: 108,496,065 probably null Het
Other mutations in Cacng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Cacng1 APN 11 107704369 missense probably benign
IGL02623:Cacng1 APN 11 107704319 missense probably damaging 1.00
R0920:Cacng1 UTSW 11 107705856 splice site probably benign
R2042:Cacng1 UTSW 11 107704308 missense probably damaging 1.00
R3906:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R3908:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R3909:Cacng1 UTSW 11 107716292 missense probably benign 0.00
R7158:Cacng1 UTSW 11 107703839 missense probably damaging 0.99
R7473:Cacng1 UTSW 11 107716192 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTGCCAACAAACTCTGCTC -3'
(R):5'- ACTGCCACCATCTAGCTAGCTG -3'

Sequencing Primer
(F):5'- CTTATCTTGGAGTCTTGAAAGGAC -3'
(R):5'- ATCTAGCTAGCTGCCTGGGAG -3'
Posted On2016-07-06