Mutagenetix > Incidental Mutations

Incidental Mutation 'R5247:Atad2'

401209

Institutional Source

Beutler Lab

Gene Symbol

Atad2

Ensembl Gene

ENSMUSG00000022360

Gene Name

ATPase family, AAA domain containing 2

Synonyms

2610509G12Rik

MMRRC Submission

042818-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R5247 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58094044-58135082 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 58104478 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 585 (L585*)

Ref Sequence

ENSEMBL: ENSMUSP00000153936 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038194] [ENSMUST00000228783]

Predicted Effect

probably null
Transcript: ENSMUST00000038194
AA Change: L909*

SMART Domains

Protein: ENSMUSP00000043691
Gene: ENSMUSG00000022360
AA Change: L909*

Domain	Start	End	E-Value	Type
low complexity region	12	35	N/A	INTRINSIC
low complexity region	36	47	N/A	INTRINSIC
low complexity region	184	199	N/A	INTRINSIC
low complexity region	237	268	N/A	INTRINSIC
low complexity region	337	349	N/A	INTRINSIC
AAA	438	579	9.93e-21	SMART
low complexity region	622	633	N/A	INTRINSIC
SCOP:d1e32a2	751	912	5e-4	SMART
low complexity region	924	947	N/A	INTRINSIC
BROMO	955	1067	1.2e-19	SMART
low complexity region	1213	1235	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226507

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226526

Predicted Effect

probably null
Transcript: ENSMUST00000228783
AA Change: L585*

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankar	A	T	1: 72,680,184	V502E	probably benign	Het
Atp6v0a2	T	C	5: 124,713,177	S475P	probably damaging	Het
BC067074	A	T	13: 113,319,459	I680F	probably damaging	Het
Cacng1	T	C	11: 107,716,279	H38R	probably benign	Het
Celsr2	A	G	3: 108,397,630	V2168A	probably benign	Het
Cnot4	C	T	6: 35,051,416	V422I	probably damaging	Het
Col1a1	T	C	11: 94,947,187		probably null	Het
Ctcfl	A	T	2: 173,113,609	C287S	probably damaging	Het
Eps8l1	T	A	7: 4,470,402	D133E	probably damaging	Het
Fam161b	A	G	12: 84,357,750	L52P	probably damaging	Het
Fam98c	T	C	7: 29,155,701	E99G	possibly damaging	Het
Fmn2	A	T	1: 174,821,228	I1574L	probably benign	Het
Gabrb3	T	A	7: 57,590,591	L8Q	possibly damaging	Het
Gm21964	T	C	8: 110,110,577	F299S	probably damaging	Het
Gm8251	A	C	1: 44,057,006	L1644*	probably null	Het
Hck	A	T	2: 153,134,695	K250*	probably null	Het
Herc1	A	G	9: 66,434,551	E1874G	probably benign	Het
Igf2	G	T	7: 142,653,931	A143D	possibly damaging	Het
Isg20l2	A	G	3: 87,931,613	N44D	possibly damaging	Het
Kdm7a	T	A	6: 39,144,456	Q855L	probably benign	Het
Kif15	T	C	9: 122,986,442	S434P	possibly damaging	Het
Klrc3	A	T	6: 129,641,462	N119K	probably damaging	Het
L3mbtl3	T	C	10: 26,327,808	M375V	unknown	Het
Lpcat4	A	G	2: 112,242,515	H173R	possibly damaging	Het
Mapk13	A	T	17: 28,777,751	Q264L	probably benign	Het
Mrps18c	C	G	5: 100,798,793	C8W	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nlrp4b	T	A	7: 10,714,218	I116N	probably benign	Het
Olfr1489	T	A	19: 13,633,414	F101Y	probably damaging	Het
Olfr239	A	G	17: 33,199,530	T161A	probably benign	Het
Prdm1	A	T	10: 44,440,102	H679Q	probably damaging	Het
Prickle2	T	A	6: 92,375,969	S839C	probably damaging	Het
Rps19	T	A	7: 24,885,453	S36T	probably damaging	Het
Serpinb1a	T	A	13: 32,850,406	M1L	probably damaging	Het
Slc16a7	A	T	10: 125,231,314	M152K	probably damaging	Het
Srpk3	C	T	X: 73,774,949	R82*	probably null	Het
Stx18	A	T	5: 38,106,633	Y141F	probably damaging	Het
Tgfb2	A	T	1: 186,649,914		probably null	Het
Tmem151b	A	T	17: 45,545,645	Y290N	probably damaging	Het
Ttn	G	A	2: 76,728,422	T29705M	probably damaging	Het
Tymp	GC	GCC	15: 89,374,364		probably null	Het
Usp19	T	G	9: 108,496,065		probably null	Het

Other mutations in Atad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Atad2	APN	15	58116820	missense	probably damaging	1.00
IGL00556:Atad2	APN	15	58100080	missense	probably damaging	1.00
IGL00674:Atad2	APN	15	58108386	missense	possibly damaging	0.49
IGL01407:Atad2	APN	15	58104525	missense	probably benign
IGL02557:Atad2	APN	15	58122597	missense	probably benign	0.04
IGL03060:Atad2	APN	15	58122446	unclassified	probably benign
IGL03308:Atad2	APN	15	58102523	missense	probably benign	0.00
R0113:Atad2	UTSW	15	58120934	unclassified	probably benign
R0195:Atad2	UTSW	15	58099954	splice site	probably benign
R0310:Atad2	UTSW	15	58114257	missense	probably damaging	1.00
R0499:Atad2	UTSW	15	58103240	missense	possibly damaging	0.92
R0499:Atad2	UTSW	15	58120949	missense	probably benign
R0564:Atad2	UTSW	15	58125833	splice site	probably benign
R0578:Atad2	UTSW	15	58105568	missense	probably damaging	1.00
R0581:Atad2	UTSW	15	58126664	missense	probably benign
R0667:Atad2	UTSW	15	58098719	missense	probably benign	0.01
R0697:Atad2	UTSW	15	58105543	missense	possibly damaging	0.91
R1219:Atad2	UTSW	15	58134911	missense	probably benign	0.00
R1271:Atad2	UTSW	15	58126589	missense	probably benign	0.00
R1544:Atad2	UTSW	15	58103364	missense	probably damaging	1.00
R1624:Atad2	UTSW	15	58100019	missense	probably damaging	1.00
R1853:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1854:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1855:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1860:Atad2	UTSW	15	58096718	splice site	probably null
R1861:Atad2	UTSW	15	58096718	splice site	probably null
R1876:Atad2	UTSW	15	58106868	missense	probably benign	0.00
R1938:Atad2	UTSW	15	58096705	missense	possibly damaging	0.76
R2158:Atad2	UTSW	15	58098566	missense	possibly damaging	0.95
R3756:Atad2	UTSW	15	58099723	missense	probably benign	0.01
R4256:Atad2	UTSW	15	58116856	missense	probably damaging	1.00
R4762:Atad2	UTSW	15	58108362	missense	probably benign
R4827:Atad2	UTSW	15	58108348	missense	probably benign	0.07
R4838:Atad2	UTSW	15	58103283	missense	probably damaging	1.00
R5238:Atad2	UTSW	15	58108337	missense	possibly damaging	0.90
R5685:Atad2	UTSW	15	58116798	missense	possibly damaging	0.95
R5790:Atad2	UTSW	15	58126594	missense	probably damaging	1.00
R5813:Atad2	UTSW	15	58099854	missense	probably benign	0.42
R5886:Atad2	UTSW	15	58098514	nonsense	probably null
R5955:Atad2	UTSW	15	58105659	missense	probably benign	0.06
R6034:Atad2	UTSW	15	58108563	missense	probably damaging	1.00
R6034:Atad2	UTSW	15	58108563	missense	probably damaging	1.00
R6111:Atad2	UTSW	15	58108091	missense	probably benign	0.07
R6209:Atad2	UTSW	15	58118415	missense	probably damaging	1.00
R6587:Atad2	UTSW	15	58121048	missense	probably benign	0.03
R6856:Atad2	UTSW	15	58106813	missense	probably damaging	1.00
R7106:Atad2	UTSW	15	58116766	critical splice donor site	probably null
R7178:Atad2	UTSW	15	58117293	missense	probably damaging	1.00
R7290:Atad2	UTSW	15	58098651	missense	probably benign	0.00
R7421:Atad2	UTSW	15	58134926	missense	probably benign	0.40
R7583:Atad2	UTSW	15	58126664	missense	probably benign
R7861:Atad2	UTSW	15	58125780	missense	probably benign	0.10
R7886:Atad2	UTSW	15	58126136	missense	probably damaging	1.00
R8072:Atad2	UTSW	15	58099978	missense	possibly damaging	0.96
R8126:Atad2	UTSW	15	58105591	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TAGCAGGAAGTAGAGCCATTTTAAG -3'
(R):5'- ACGAATTTAACGCGTCTATCCATAC -3'

Sequencing Primer
(F):5'- GTCATAAATATGTCACTCCCGTAAC -3'
(R):5'- ATGCCCTGGAGCTAGAGTTAC -3'

Posted On

2016-07-06