Incidental Mutation 'R5247:Atad2'
ID401209
Institutional Source Beutler Lab
Gene Symbol Atad2
Ensembl Gene ENSMUSG00000022360
Gene NameATPase family, AAA domain containing 2
Synonyms2610509G12Rik
MMRRC Submission 042818-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R5247 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location58094044-58135082 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58104478 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 585 (L585*)
Ref Sequence ENSEMBL: ENSMUSP00000153936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038194] [ENSMUST00000228783]
Predicted Effect probably null
Transcript: ENSMUST00000038194
AA Change: L909*
SMART Domains Protein: ENSMUSP00000043691
Gene: ENSMUSG00000022360
AA Change: L909*

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
low complexity region 237 268 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
AAA 438 579 9.93e-21 SMART
low complexity region 622 633 N/A INTRINSIC
SCOP:d1e32a2 751 912 5e-4 SMART
low complexity region 924 947 N/A INTRINSIC
BROMO 955 1067 1.2e-19 SMART
low complexity region 1213 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226526
Predicted Effect probably null
Transcript: ENSMUST00000228783
AA Change: L585*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankar A T 1: 72,680,184 V502E probably benign Het
Atp6v0a2 T C 5: 124,713,177 S475P probably damaging Het
BC067074 A T 13: 113,319,459 I680F probably damaging Het
Cacng1 T C 11: 107,716,279 H38R probably benign Het
Celsr2 A G 3: 108,397,630 V2168A probably benign Het
Cnot4 C T 6: 35,051,416 V422I probably damaging Het
Col1a1 T C 11: 94,947,187 probably null Het
Ctcfl A T 2: 173,113,609 C287S probably damaging Het
Eps8l1 T A 7: 4,470,402 D133E probably damaging Het
Fam161b A G 12: 84,357,750 L52P probably damaging Het
Fam98c T C 7: 29,155,701 E99G possibly damaging Het
Fmn2 A T 1: 174,821,228 I1574L probably benign Het
Gabrb3 T A 7: 57,590,591 L8Q possibly damaging Het
Gm21964 T C 8: 110,110,577 F299S probably damaging Het
Gm8251 A C 1: 44,057,006 L1644* probably null Het
Hck A T 2: 153,134,695 K250* probably null Het
Herc1 A G 9: 66,434,551 E1874G probably benign Het
Igf2 G T 7: 142,653,931 A143D possibly damaging Het
Isg20l2 A G 3: 87,931,613 N44D possibly damaging Het
Kdm7a T A 6: 39,144,456 Q855L probably benign Het
Kif15 T C 9: 122,986,442 S434P possibly damaging Het
Klrc3 A T 6: 129,641,462 N119K probably damaging Het
L3mbtl3 T C 10: 26,327,808 M375V unknown Het
Lpcat4 A G 2: 112,242,515 H173R possibly damaging Het
Mapk13 A T 17: 28,777,751 Q264L probably benign Het
Mrps18c C G 5: 100,798,793 C8W probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nlrp4b T A 7: 10,714,218 I116N probably benign Het
Olfr1489 T A 19: 13,633,414 F101Y probably damaging Het
Olfr239 A G 17: 33,199,530 T161A probably benign Het
Prdm1 A T 10: 44,440,102 H679Q probably damaging Het
Prickle2 T A 6: 92,375,969 S839C probably damaging Het
Rps19 T A 7: 24,885,453 S36T probably damaging Het
Serpinb1a T A 13: 32,850,406 M1L probably damaging Het
Slc16a7 A T 10: 125,231,314 M152K probably damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Stx18 A T 5: 38,106,633 Y141F probably damaging Het
Tgfb2 A T 1: 186,649,914 probably null Het
Tmem151b A T 17: 45,545,645 Y290N probably damaging Het
Ttn G A 2: 76,728,422 T29705M probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Usp19 T G 9: 108,496,065 probably null Het
Other mutations in Atad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Atad2 APN 15 58116820 missense probably damaging 1.00
IGL00556:Atad2 APN 15 58100080 missense probably damaging 1.00
IGL00674:Atad2 APN 15 58108386 missense possibly damaging 0.49
IGL01407:Atad2 APN 15 58104525 missense probably benign
IGL02557:Atad2 APN 15 58122597 missense probably benign 0.04
IGL03060:Atad2 APN 15 58122446 unclassified probably benign
IGL03308:Atad2 APN 15 58102523 missense probably benign 0.00
R0113:Atad2 UTSW 15 58120934 unclassified probably benign
R0195:Atad2 UTSW 15 58099954 splice site probably benign
R0310:Atad2 UTSW 15 58114257 missense probably damaging 1.00
R0499:Atad2 UTSW 15 58103240 missense possibly damaging 0.92
R0499:Atad2 UTSW 15 58120949 missense probably benign
R0564:Atad2 UTSW 15 58125833 splice site probably benign
R0578:Atad2 UTSW 15 58105568 missense probably damaging 1.00
R0581:Atad2 UTSW 15 58126664 missense probably benign
R0667:Atad2 UTSW 15 58098719 missense probably benign 0.01
R0697:Atad2 UTSW 15 58105543 missense possibly damaging 0.91
R1219:Atad2 UTSW 15 58134911 missense probably benign 0.00
R1271:Atad2 UTSW 15 58126589 missense probably benign 0.00
R1544:Atad2 UTSW 15 58103364 missense probably damaging 1.00
R1624:Atad2 UTSW 15 58100019 missense probably damaging 1.00
R1853:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1854:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1855:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1860:Atad2 UTSW 15 58096718 splice site probably null
R1861:Atad2 UTSW 15 58096718 splice site probably null
R1876:Atad2 UTSW 15 58106868 missense probably benign 0.00
R1938:Atad2 UTSW 15 58096705 missense possibly damaging 0.76
R2158:Atad2 UTSW 15 58098566 missense possibly damaging 0.95
R3756:Atad2 UTSW 15 58099723 missense probably benign 0.01
R4256:Atad2 UTSW 15 58116856 missense probably damaging 1.00
R4762:Atad2 UTSW 15 58108362 missense probably benign
R4827:Atad2 UTSW 15 58108348 missense probably benign 0.07
R4838:Atad2 UTSW 15 58103283 missense probably damaging 1.00
R5238:Atad2 UTSW 15 58108337 missense possibly damaging 0.90
R5685:Atad2 UTSW 15 58116798 missense possibly damaging 0.95
R5790:Atad2 UTSW 15 58126594 missense probably damaging 1.00
R5813:Atad2 UTSW 15 58099854 missense probably benign 0.42
R5886:Atad2 UTSW 15 58098514 nonsense probably null
R5955:Atad2 UTSW 15 58105659 missense probably benign 0.06
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6111:Atad2 UTSW 15 58108091 missense probably benign 0.07
R6209:Atad2 UTSW 15 58118415 missense probably damaging 1.00
R6587:Atad2 UTSW 15 58121048 missense probably benign 0.03
R6856:Atad2 UTSW 15 58106813 missense probably damaging 1.00
R7106:Atad2 UTSW 15 58116766 critical splice donor site probably null
R7178:Atad2 UTSW 15 58117293 missense probably damaging 1.00
R7290:Atad2 UTSW 15 58098651 missense probably benign 0.00
R7421:Atad2 UTSW 15 58134926 missense probably benign 0.40
R7583:Atad2 UTSW 15 58126664 missense probably benign
R7861:Atad2 UTSW 15 58125780 missense probably benign 0.10
R7886:Atad2 UTSW 15 58126136 missense probably damaging 1.00
R8072:Atad2 UTSW 15 58099978 missense possibly damaging 0.96
R8126:Atad2 UTSW 15 58105591 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGCAGGAAGTAGAGCCATTTTAAG -3'
(R):5'- ACGAATTTAACGCGTCTATCCATAC -3'

Sequencing Primer
(F):5'- GTCATAAATATGTCACTCCCGTAAC -3'
(R):5'- ATGCCCTGGAGCTAGAGTTAC -3'
Posted On2016-07-06