Incidental Mutation 'R5258:Olfr1164'
ID401221
Institutional Source Beutler Lab
Gene Symbol Olfr1164
Ensembl Gene ENSMUSG00000075136
Gene Nameolfactory receptor 1164
SynonymsMOR174-11, GA_x6K02T2Q125-49585842-49584862
MMRRC Submission 042828-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5258 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88092855-88093966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88093418 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 173 (Y173N)
Ref Sequence ENSEMBL: ENSMUSP00000097422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099834]
Predicted Effect probably benign
Transcript: ENSMUST00000099834
AA Change: Y173N

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097422
Gene: ENSMUSG00000075136
AA Change: Y173N

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 3.8e-47 PFAM
Pfam:7tm_1 53 302 2.9e-15 PFAM
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,333 probably benign Het
3425401B19Rik T A 14: 32,663,309 D233V probably damaging Het
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Abcc8 T C 7: 46,108,387 I1313V probably benign Het
Abcc8 C T 7: 46,157,148 V379I probably benign Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
B3gnt7 A G 1: 86,305,565 K61E possibly damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Cd1d2 C G 3: 86,987,647 R147G possibly damaging Het
Cfap69 T C 5: 5,604,271 probably null Het
Ddx46 T C 13: 55,653,024 F331L possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gm12887 T C 4: 121,615,700 K82E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Invs A G 4: 48,396,374 D349G possibly damaging Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Lipo3 T A 19: 33,613,843 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Map3k6 T C 4: 133,247,642 V662A possibly damaging Het
Megf8 T A 7: 25,348,326 F1645I possibly damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mib1 G A 18: 10,795,856 probably null Het
Mrps6 T A 16: 92,099,655 V36E probably damaging Het
Nhsl1 C A 10: 18,524,322 S432* probably null Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Nlrp4c T A 7: 6,066,623 S508T probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptprg A G 14: 12,142,431 T361A probably benign Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tas2r114 T A 6: 131,689,541 I175F probably benign Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Trav14-1 C T 14: 53,554,273 H27Y probably benign Het
Trim24 A T 6: 37,919,400 Q264L probably damaging Het
Vmn2r90 A G 17: 17,712,852 I225V probably benign Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp407 C T 18: 84,315,926 V1761I probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Olfr1164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Olfr1164 APN 2 88093016 missense possibly damaging 0.48
IGL02894:Olfr1164 APN 2 88093763 missense possibly damaging 0.79
IGL02977:Olfr1164 APN 2 88093571 missense probably benign
R0234:Olfr1164 UTSW 2 88093022 nonsense probably null
R0234:Olfr1164 UTSW 2 88093022 nonsense probably null
R0480:Olfr1164 UTSW 2 88093628 missense probably benign
R0644:Olfr1164 UTSW 2 88093289 missense probably benign 0.02
R1479:Olfr1164 UTSW 2 88093286 missense probably benign 0.05
R2047:Olfr1164 UTSW 2 88093893 missense probably benign 0.01
R2311:Olfr1164 UTSW 2 88093834 missense probably benign 0.00
R2973:Olfr1164 UTSW 2 88093114 missense probably benign 0.00
R3683:Olfr1164 UTSW 2 88093259 missense probably damaging 1.00
R3685:Olfr1164 UTSW 2 88093259 missense probably damaging 1.00
R4258:Olfr1164 UTSW 2 88093018 missense probably damaging 1.00
R4811:Olfr1164 UTSW 2 88093532 missense probably benign 0.08
R4970:Olfr1164 UTSW 2 88093009 missense probably damaging 1.00
R5112:Olfr1164 UTSW 2 88093009 missense probably damaging 1.00
R5884:Olfr1164 UTSW 2 88093796 missense probably damaging 1.00
R6329:Olfr1164 UTSW 2 88093664 missense probably damaging 1.00
R6597:Olfr1164 UTSW 2 88093069 missense probably damaging 1.00
R7018:Olfr1164 UTSW 2 88093256 missense probably benign 0.00
R7055:Olfr1164 UTSW 2 88093701 missense probably damaging 1.00
R7314:Olfr1164 UTSW 2 88093114 missense probably benign 0.00
R7350:Olfr1164 UTSW 2 88093198 missense probably benign 0.01
R7527:Olfr1164 UTSW 2 88093610 missense probably damaging 1.00
R8003:Olfr1164 UTSW 2 88093245 nonsense probably null
Z1176:Olfr1164 UTSW 2 88093334 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGAATTTTGATGACAGTGACAAC -3'
(R):5'- CTTTGAAGGATGCATGGCTC -3'

Sequencing Primer
(F):5'- ACTGAAGGAGGTGTCTGA -3'
(R):5'- GAAGGATGCATGGCTCAATATTTTC -3'
Posted On2016-07-06