Incidental Mutation 'R5258:P2rx7'
ID401229
Institutional Source Beutler Lab
Gene Symbol P2rx7
Ensembl Gene ENSMUSG00000029468
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 7
SynonymsP2X7R, P2X7 receptor, P2X(7)
MMRRC Submission 042828-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5258 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122643911-122691432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122681003 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 496 (E496G)
Ref Sequence ENSEMBL: ENSMUSP00000098303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]
Predicted Effect probably benign
Transcript: ENSMUST00000031425
SMART Domains Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 1e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100737
AA Change: E496G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: E496G

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 397 3.6e-158 PFAM
low complexity region 435 451 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121489
SMART Domains Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 3.5e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199371
Meta Mutation Damage Score 0.1961 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,333 probably benign Het
3425401B19Rik T A 14: 32,663,309 D233V probably damaging Het
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Abcc8 T C 7: 46,108,387 I1313V probably benign Het
Abcc8 C T 7: 46,157,148 V379I probably benign Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
B3gnt7 A G 1: 86,305,565 K61E possibly damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Cd1d2 C G 3: 86,987,647 R147G possibly damaging Het
Cfap69 T C 5: 5,604,271 probably null Het
Ddx46 T C 13: 55,653,024 F331L possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gm12887 T C 4: 121,615,700 K82E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Invs A G 4: 48,396,374 D349G possibly damaging Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Lipo3 T A 19: 33,613,843 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Map3k6 T C 4: 133,247,642 V662A possibly damaging Het
Megf8 T A 7: 25,348,326 F1645I possibly damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mib1 G A 18: 10,795,856 probably null Het
Mrps6 T A 16: 92,099,655 V36E probably damaging Het
Nhsl1 C A 10: 18,524,322 S432* probably null Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Nlrp4c T A 7: 6,066,623 S508T probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1164 A T 2: 88,093,418 Y173N probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptprg A G 14: 12,142,431 T361A probably benign Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tas2r114 T A 6: 131,689,541 I175F probably benign Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Trav14-1 C T 14: 53,554,273 H27Y probably benign Het
Trim24 A T 6: 37,919,400 Q264L probably damaging Het
Vmn2r90 A G 17: 17,712,852 I225V probably benign Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp407 C T 18: 84,315,926 V1761I probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in P2rx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:P2rx7 APN 5 122676698 missense probably damaging 1.00
IGL01911:P2rx7 APN 5 122658768 missense probably damaging 0.99
IGL02375:P2rx7 APN 5 122673656 splice site probably benign
IGL02502:P2rx7 APN 5 122680987 missense possibly damaging 0.92
IGL03102:P2rx7 APN 5 122663605 missense possibly damaging 0.88
IGL03179:P2rx7 APN 5 122673700 missense possibly damaging 0.66
ailing UTSW 5 122673736 missense probably benign
Enfermo UTSW 5 122652789 missense probably damaging 0.98
Incapacitated UTSW 5 122673793 missense probably damaging 0.99
Sickpuppy UTSW 5 122681003 missense probably damaging 0.96
BB009:P2rx7 UTSW 5 122644182 missense probably benign 0.01
BB019:P2rx7 UTSW 5 122644182 missense probably benign 0.01
PIT1430001:P2rx7 UTSW 5 122681216 missense probably damaging 0.99
R0363:P2rx7 UTSW 5 122657030 nonsense probably null
R0558:P2rx7 UTSW 5 122673798 missense possibly damaging 0.83
R1186:P2rx7 UTSW 5 122670451 missense probably damaging 1.00
R1709:P2rx7 UTSW 5 122670465 missense possibly damaging 0.95
R1856:P2rx7 UTSW 5 122681032 missense probably damaging 1.00
R1899:P2rx7 UTSW 5 122673736 missense probably benign
R1905:P2rx7 UTSW 5 122680952 missense probably damaging 1.00
R2082:P2rx7 UTSW 5 122644095 missense possibly damaging 0.92
R2117:P2rx7 UTSW 5 122681266 missense probably benign 0.00
R2205:P2rx7 UTSW 5 122681101 missense probably damaging 1.00
R2446:P2rx7 UTSW 5 122680816 missense probably benign
R3151:P2rx7 UTSW 5 122681266 missense probably benign 0.00
R4052:P2rx7 UTSW 5 122666277 missense probably damaging 1.00
R4883:P2rx7 UTSW 5 122681066 missense probably damaging 1.00
R4930:P2rx7 UTSW 5 122670479 missense probably damaging 1.00
R5194:P2rx7 UTSW 5 122673795 missense probably benign 0.00
R5257:P2rx7 UTSW 5 122681003 missense probably damaging 0.96
R5481:P2rx7 UTSW 5 122680820 missense possibly damaging 0.89
R5656:P2rx7 UTSW 5 122673717 missense probably damaging 0.99
R5738:P2rx7 UTSW 5 122652789 missense probably damaging 0.98
R6587:P2rx7 UTSW 5 122664550 missense probably damaging 1.00
R7098:P2rx7 UTSW 5 122673793 missense probably damaging 0.99
R7120:P2rx7 UTSW 5 122681294 missense probably benign
R7180:P2rx7 UTSW 5 122680820 missense possibly damaging 0.89
R7358:P2rx7 UTSW 5 122666142 critical splice acceptor site probably null
R7724:P2rx7 UTSW 5 122673373 missense probably benign 0.07
R7932:P2rx7 UTSW 5 122644182 missense probably benign 0.01
R8240:P2rx7 UTSW 5 122655033 missense probably damaging 1.00
Z1177:P2rx7 UTSW 5 122663641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGCTGATGGGTCTGGAAAC -3'
(R):5'- TAGCACCTGTAAGCACGGTG -3'

Sequencing Primer
(F):5'- GACTTTTTCAGAGACCCCAGATGG -3'
(R):5'- TGTAAGCACGGTGTCGCAG -3'
Posted On2016-07-06