Incidental Mutation 'R5258:Tfdp1'
ID401244
Institutional Source Beutler Lab
Gene Symbol Tfdp1
Ensembl Gene ENSMUSG00000038482
Gene Nametranscription factor Dp 1
SynonymsDrtf1, Dp1
MMRRC Submission 042828-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5258 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13338751-13378448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13369529 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 86 (T86M)
Ref Sequence ENSEMBL: ENSMUSP00000147536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170909] [ENSMUST00000209282] [ENSMUST00000209396] [ENSMUST00000209885] [ENSMUST00000209945] [ENSMUST00000210165] [ENSMUST00000210501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170909
AA Change: T86M

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127952
Gene: ENSMUSG00000038482
AA Change: T86M

DomainStartEndE-ValueType
E2F_TDP 111 193 1.51e-34 SMART
DP 200 344 4.07e-90 SMART
low complexity region 395 410 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209282
AA Change: T86M

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209396
Predicted Effect possibly damaging
Transcript: ENSMUST00000209885
AA Change: T86M

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209945
AA Change: T22M

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210165
AA Change: T28M

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210501
AA Change: T86M

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211606
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transcription factors that heterodimerize with E2F proteins to enhance their DNA-binding activity and promote transcription from E2F target genes. The encoded protein functions as part of this complex to control the transcriptional activity of numerous genes involved in cell cycle progression from G1 to S phase. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1, 15, and X.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced expansion of the ectoplacental cone and chorion, small yolk sacs, and impaired endoreduplication in trophoblast giant cells. Mutants die by embryonic day 12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,333 probably benign Het
3425401B19Rik T A 14: 32,663,309 D233V probably damaging Het
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Abcc8 T C 7: 46,108,387 I1313V probably benign Het
Abcc8 C T 7: 46,157,148 V379I probably benign Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
B3gnt7 A G 1: 86,305,565 K61E possibly damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Cd1d2 C G 3: 86,987,647 R147G possibly damaging Het
Cfap69 T C 5: 5,604,271 probably null Het
Ddx46 T C 13: 55,653,024 F331L possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gm12887 T C 4: 121,615,700 K82E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Invs A G 4: 48,396,374 D349G possibly damaging Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Lipo3 T A 19: 33,613,843 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Map3k6 T C 4: 133,247,642 V662A possibly damaging Het
Megf8 T A 7: 25,348,326 F1645I possibly damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mib1 G A 18: 10,795,856 probably null Het
Mrps6 T A 16: 92,099,655 V36E probably damaging Het
Nhsl1 C A 10: 18,524,322 S432* probably null Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Nlrp4c T A 7: 6,066,623 S508T probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1164 A T 2: 88,093,418 Y173N probably benign Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptprg A G 14: 12,142,431 T361A probably benign Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tas2r114 T A 6: 131,689,541 I175F probably benign Het
Tex2 T A 11: 106,567,759 probably benign Het
Trav14-1 C T 14: 53,554,273 H27Y probably benign Het
Trim24 A T 6: 37,919,400 Q264L probably damaging Het
Vmn2r90 A G 17: 17,712,852 I225V probably benign Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp407 C T 18: 84,315,926 V1761I probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Tfdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Tfdp1 APN 8 13369546 missense possibly damaging 0.95
gangly UTSW 8 13357038 splice site probably null
PIT1430001:Tfdp1 UTSW 8 13372526 missense probably benign 0.35
R1139:Tfdp1 UTSW 8 13373000 missense probably benign 0.14
R1264:Tfdp1 UTSW 8 13373837 splice site probably benign
R1485:Tfdp1 UTSW 8 13370917 missense probably damaging 0.99
R1967:Tfdp1 UTSW 8 13373039 missense possibly damaging 0.59
R4849:Tfdp1 UTSW 8 13373895 missense probably benign
R4965:Tfdp1 UTSW 8 13373073 missense probably damaging 0.99
R5257:Tfdp1 UTSW 8 13369529 missense possibly damaging 0.92
R5895:Tfdp1 UTSW 8 13357038 splice site probably null
R6785:Tfdp1 UTSW 8 13370485 missense probably damaging 0.99
R6785:Tfdp1 UTSW 8 13377233 missense possibly damaging 0.85
R6786:Tfdp1 UTSW 8 13370485 missense probably damaging 0.99
R8144:Tfdp1 UTSW 8 13373015 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGATGTACGGGTGTCTGAGC -3'
(R):5'- CACTTTCTAAGCGTTTGTGTCG -3'

Sequencing Primer
(F):5'- TGCCACAGCAGAGCAGC -3'
(R):5'- TTCTCTGTGGCCCAGTCAGAG -3'
Posted On2016-07-06