Incidental Mutation 'R5258:Asf1b'
ID401246
Institutional Source Beutler Lab
Gene Symbol Asf1b
Ensembl Gene ENSMUSG00000005470
Gene Nameanti-silencing function 1B histone chaperone
Synonyms1700003K02Rik
MMRRC Submission 042828-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5258 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83955507-83970197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83969267 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 179 (T179I)
Ref Sequence ENSEMBL: ENSMUSP00000005607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005606] [ENSMUST00000005607]
Predicted Effect probably benign
Transcript: ENSMUST00000005606
SMART Domains Protein: ENSMUSP00000005606
Gene: ENSMUSG00000005469

DomainStartEndE-ValueType
S_TKc 44 298 2e-107 SMART
S_TK_X 299 344 3.7e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000005607
AA Change: T179I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005607
Gene: ENSMUSG00000005470
AA Change: T179I

DomainStartEndE-ValueType
Pfam:ASF1_hist_chap 1 154 1.2e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124913
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the H3/H4 family of histone chaperone proteins and is similar to the anti-silencing function-1 gene in yeast. The encoded protein is the substrate of the tousled-like kinase family of cell cycle-regulated kinases, and may play a key role in modulating the nucleosome structure of chromatin by ensuring a constant supply of histones at sites of nucleosome assembly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are viable and fertile and exhibit no overt abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,333 probably benign Het
3425401B19Rik T A 14: 32,663,309 D233V probably damaging Het
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Abcc8 T C 7: 46,108,387 I1313V probably benign Het
Abcc8 C T 7: 46,157,148 V379I probably benign Het
Acpp T C 9: 104,309,475 I266V probably benign Het
B3gnt7 A G 1: 86,305,565 K61E possibly damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Cd1d2 C G 3: 86,987,647 R147G possibly damaging Het
Cfap69 T C 5: 5,604,271 probably null Het
Ddx46 T C 13: 55,653,024 F331L possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gm12887 T C 4: 121,615,700 K82E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Invs A G 4: 48,396,374 D349G possibly damaging Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Lipo3 T A 19: 33,613,843 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Map3k6 T C 4: 133,247,642 V662A possibly damaging Het
Megf8 T A 7: 25,348,326 F1645I possibly damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mib1 G A 18: 10,795,856 probably null Het
Mrps6 T A 16: 92,099,655 V36E probably damaging Het
Nhsl1 C A 10: 18,524,322 S432* probably null Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Nlrp4c T A 7: 6,066,623 S508T probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1164 A T 2: 88,093,418 Y173N probably benign Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptprg A G 14: 12,142,431 T361A probably benign Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tas2r114 T A 6: 131,689,541 I175F probably benign Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Trav14-1 C T 14: 53,554,273 H27Y probably benign Het
Trim24 A T 6: 37,919,400 Q264L probably damaging Het
Vmn2r90 A G 17: 17,712,852 I225V probably benign Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp407 C T 18: 84,315,926 V1761I probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Asf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Asf1b APN 8 83955904 missense probably benign 0.01
IGL02504:Asf1b APN 8 83955829 start codon destroyed probably null 0.99
IGL03172:Asf1b APN 8 83967913 missense probably benign 0.05
contraire UTSW 8 83955911 missense probably damaging 1.00
PIT4449001:Asf1b UTSW 8 83967982 missense probably benign 0.01
R5156:Asf1b UTSW 8 83955911 missense probably damaging 1.00
R5257:Asf1b UTSW 8 83969267 missense probably benign
R7610:Asf1b UTSW 8 83965049 missense probably damaging 0.97
R8300:Asf1b UTSW 8 83969176 missense possibly damaging 0.83
Z1088:Asf1b UTSW 8 83969152 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCTTTCAGGCTCAAAGTGG -3'
(R):5'- GTGGTCCCCAAATCCTTGAG -3'

Sequencing Primer
(F):5'- CAGGCTCAAAGTGGAGGTTTG -3'
(R):5'- CCTTGAGATGACCAAGCATGTCTG -3'
Posted On2016-07-06