Incidental Mutation 'R5258:1110032A03Rik'
ID401247
Institutional Source Beutler Lab
Gene Symbol 1110032A03Rik
Ensembl Gene ENSMUSG00000037971
Gene NameRIKEN cDNA 1110032A03 gene
Synonyms
MMRRC Submission 042828-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5258 (G1)
Quality Score150
Status Validated
Chromosome9
Chromosomal Location50762828-50775520 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 50764333 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042391] [ENSMUST00000042468] [ENSMUST00000042576] [ENSMUST00000176145] [ENSMUST00000176238] [ENSMUST00000176335] [ENSMUST00000177546]
Predicted Effect probably benign
Transcript: ENSMUST00000042391
SMART Domains Protein: ENSMUSP00000037082
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 176 1.4e-44 PFAM
low complexity region 258 269 N/A INTRINSIC
SCOP:d1jjca_ 487 516 6e-4 SMART
FDX-ACB 528 622 5.88e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042468
SMART Domains Protein: ENSMUSP00000041803
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 149 7.7e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042576
SMART Domains Protein: ENSMUSP00000046890
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 15 164 1.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176145
SMART Domains Protein: ENSMUSP00000135796
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
Pfam:DUF2431 7 115 4.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176160
Predicted Effect probably benign
Transcript: ENSMUST00000176238
SMART Domains Protein: ENSMUSP00000135679
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 1 70 4.2e-47 PFAM
Pfam:DUF1143 68 126 5.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176335
SMART Domains Protein: ENSMUSP00000135658
Gene: ENSMUSG00000037845

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1jjca_ 285 314 3e-4 SMART
FDX-ACB 326 420 5.88e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177142
Predicted Effect probably benign
Transcript: ENSMUST00000177546
SMART Domains Protein: ENSMUSP00000134870
Gene: ENSMUSG00000037971

DomainStartEndE-ValueType
Pfam:DUF1143 13 72 3.3e-39 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,663,309 D233V probably damaging Het
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Abcc8 T C 7: 46,108,387 I1313V probably benign Het
Abcc8 C T 7: 46,157,148 V379I probably benign Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
B3gnt7 A G 1: 86,305,565 K61E possibly damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Cd1d2 C G 3: 86,987,647 R147G possibly damaging Het
Cfap69 T C 5: 5,604,271 probably null Het
Ddx46 T C 13: 55,653,024 F331L possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gm12887 T C 4: 121,615,700 K82E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Invs A G 4: 48,396,374 D349G possibly damaging Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Lipo3 T A 19: 33,613,843 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Map3k6 T C 4: 133,247,642 V662A possibly damaging Het
Megf8 T A 7: 25,348,326 F1645I possibly damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mib1 G A 18: 10,795,856 probably null Het
Mrps6 T A 16: 92,099,655 V36E probably damaging Het
Nhsl1 C A 10: 18,524,322 S432* probably null Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Nlrp4c T A 7: 6,066,623 S508T probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1164 A T 2: 88,093,418 Y173N probably benign Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptprg A G 14: 12,142,431 T361A probably benign Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tas2r114 T A 6: 131,689,541 I175F probably benign Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Trav14-1 C T 14: 53,554,273 H27Y probably benign Het
Trim24 A T 6: 37,919,400 Q264L probably damaging Het
Vmn2r90 A G 17: 17,712,852 I225V probably benign Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp407 C T 18: 84,315,926 V1761I probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in 1110032A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1535:1110032A03Rik UTSW 9 50764007 missense probably damaging 0.97
R2145:1110032A03Rik UTSW 9 50764874 missense probably damaging 1.00
R3748:1110032A03Rik UTSW 9 50765750 missense probably benign 0.00
R5337:1110032A03Rik UTSW 9 50765749 missense probably benign
R5408:1110032A03Rik UTSW 9 50764757 missense probably damaging 1.00
R5672:1110032A03Rik UTSW 9 50763927 missense probably benign 0.03
R6242:1110032A03Rik UTSW 9 50763915 missense probably benign 0.00
R6326:1110032A03Rik UTSW 9 50764757 missense probably damaging 1.00
R7440:1110032A03Rik UTSW 9 50764913 missense probably benign 0.01
R7908:1110032A03Rik UTSW 9 50763948 missense possibly damaging 0.73
RF008:1110032A03Rik UTSW 9 50765767 missense probably benign 0.02
Z1176:1110032A03Rik UTSW 9 50768219 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTCTATCTGCTGGGGACTG -3'
(R):5'- TTGCCTTCTCAGATGACAAACC -3'

Sequencing Primer
(F):5'- ACTGCGATGGGTGCTAGGAG -3'
(R):5'- CACGTGTGTGTATGTGGGG -3'
Posted On2016-07-06