Incidental Mutation 'R5258:Nhsl1'
ID401250
Institutional Source Beutler Lab
Gene Symbol Nhsl1
Ensembl Gene ENSMUSG00000039835
Gene NameNHS-like 1
Synonyms5730409E15Rik, D10Bwg0940e, A630035H13Rik
MMRRC Submission 042828-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5258 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location18318985-18533892 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 18524322 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 432 (S432*)
Ref Sequence ENSEMBL: ENSMUSP00000147021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037341] [ENSMUST00000100054] [ENSMUST00000162891] [ENSMUST00000207038]
Predicted Effect probably null
Transcript: ENSMUST00000037341
AA Change: S402*
SMART Domains Protein: ENSMUSP00000040799
Gene: ENSMUSG00000039835
AA Change: S402*

DomainStartEndE-ValueType
Pfam:NHS 258 906 1.6e-246 PFAM
low complexity region 918 938 N/A INTRINSIC
low complexity region 942 950 N/A INTRINSIC
low complexity region 958 970 N/A INTRINSIC
low complexity region 992 1024 N/A INTRINSIC
low complexity region 1171 1197 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
low complexity region 1442 1460 N/A INTRINSIC
low complexity region 1484 1503 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100054
AA Change: S398*
SMART Domains Protein: ENSMUSP00000097631
Gene: ENSMUSG00000039835
AA Change: S398*

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 7.3e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
low complexity region 938 946 N/A INTRINSIC
low complexity region 954 966 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
low complexity region 1167 1193 N/A INTRINSIC
low complexity region 1369 1381 N/A INTRINSIC
low complexity region 1438 1456 N/A INTRINSIC
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159299
SMART Domains Protein: ENSMUSP00000124629
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162891
AA Change: S398*
SMART Domains Protein: ENSMUSP00000124072
Gene: ENSMUSG00000039835
AA Change: S398*

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 2.1e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207038
AA Change: S432*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,333 probably benign Het
3425401B19Rik T A 14: 32,663,309 D233V probably damaging Het
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Abcc8 T C 7: 46,108,387 I1313V probably benign Het
Abcc8 C T 7: 46,157,148 V379I probably benign Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
B3gnt7 A G 1: 86,305,565 K61E possibly damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Cd1d2 C G 3: 86,987,647 R147G possibly damaging Het
Cfap69 T C 5: 5,604,271 probably null Het
Ddx46 T C 13: 55,653,024 F331L possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gm12887 T C 4: 121,615,700 K82E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Invs A G 4: 48,396,374 D349G possibly damaging Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Lipo3 T A 19: 33,613,843 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Map3k6 T C 4: 133,247,642 V662A possibly damaging Het
Megf8 T A 7: 25,348,326 F1645I possibly damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mib1 G A 18: 10,795,856 probably null Het
Mrps6 T A 16: 92,099,655 V36E probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Nlrp4c T A 7: 6,066,623 S508T probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1164 A T 2: 88,093,418 Y173N probably benign Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptprg A G 14: 12,142,431 T361A probably benign Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tas2r114 T A 6: 131,689,541 I175F probably benign Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Trav14-1 C T 14: 53,554,273 H27Y probably benign Het
Trim24 A T 6: 37,919,400 Q264L probably damaging Het
Vmn2r90 A G 17: 17,712,852 I225V probably benign Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp407 C T 18: 84,315,926 V1761I probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Nhsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Nhsl1 APN 10 18527609 missense probably benign 0.07
IGL01121:Nhsl1 APN 10 18511710 missense probably damaging 1.00
IGL01775:Nhsl1 APN 10 18524474 missense probably damaging 0.99
IGL02143:Nhsl1 APN 10 18511635 missense possibly damaging 0.74
IGL02606:Nhsl1 APN 10 18511637 missense probably damaging 1.00
IGL02642:Nhsl1 APN 10 18408390 missense possibly damaging 0.96
IGL02866:Nhsl1 APN 10 18527607 missense probably damaging 0.99
IGL03263:Nhsl1 APN 10 18498079 nonsense probably null
IGL03380:Nhsl1 APN 10 18523879 nonsense probably null
PIT4651001:Nhsl1 UTSW 10 18408435 missense probably damaging 0.98
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0116:Nhsl1 UTSW 10 18525242 nonsense probably null
R0245:Nhsl1 UTSW 10 18525108 missense probably damaging 1.00
R0254:Nhsl1 UTSW 10 18472985 missense probably damaging 1.00
R0288:Nhsl1 UTSW 10 18524046 missense probably damaging 1.00
R0648:Nhsl1 UTSW 10 18531726 missense possibly damaging 0.92
R1055:Nhsl1 UTSW 10 18525475 missense probably benign 0.08
R1300:Nhsl1 UTSW 10 18408461 missense probably benign
R1384:Nhsl1 UTSW 10 18408513 missense probably null 0.96
R1453:Nhsl1 UTSW 10 18531575 missense probably damaging 1.00
R1523:Nhsl1 UTSW 10 18408355 missense probably benign
R1595:Nhsl1 UTSW 10 18526348 missense probably damaging 0.98
R1786:Nhsl1 UTSW 10 18524664 missense probably benign 0.28
R1836:Nhsl1 UTSW 10 18524905 missense possibly damaging 0.87
R1878:Nhsl1 UTSW 10 18524279 missense probably damaging 1.00
R2013:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2014:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2015:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R3115:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3116:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3754:Nhsl1 UTSW 10 18516034 missense probably damaging 0.99
R4342:Nhsl1 UTSW 10 18526689 missense probably damaging 1.00
R4595:Nhsl1 UTSW 10 18527609 missense probably benign 0.07
R4604:Nhsl1 UTSW 10 18531410 missense probably damaging 0.99
R4666:Nhsl1 UTSW 10 18531405 missense probably damaging 1.00
R5223:Nhsl1 UTSW 10 18526326 missense probably damaging 1.00
R5707:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R5796:Nhsl1 UTSW 10 18524250 missense probably benign 0.06
R5960:Nhsl1 UTSW 10 18526976 missense probably benign
R6190:Nhsl1 UTSW 10 18470041 intron probably benign
R6272:Nhsl1 UTSW 10 18524505 missense probably benign 0.01
R6677:Nhsl1 UTSW 10 18525862 missense probably damaging 0.98
R6714:Nhsl1 UTSW 10 18524711 missense possibly damaging 0.74
R6765:Nhsl1 UTSW 10 18531314 missense probably benign 0.01
R6892:Nhsl1 UTSW 10 18524343 missense probably damaging 1.00
R7049:Nhsl1 UTSW 10 18531638 missense probably damaging 0.99
R7060:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R7236:Nhsl1 UTSW 10 18525764 missense probably damaging 1.00
R7299:Nhsl1 UTSW 10 18527671 splice site probably null
R7305:Nhsl1 UTSW 10 18531686 missense possibly damaging 0.94
R7513:Nhsl1 UTSW 10 18523952 missense probably damaging 1.00
R7566:Nhsl1 UTSW 10 18516119 missense probably damaging 1.00
R8008:Nhsl1 UTSW 10 18408438 missense probably damaging 0.96
R8135:Nhsl1 UTSW 10 18531432 missense probably damaging 1.00
R8240:Nhsl1 UTSW 10 18526739 missense probably benign 0.34
Z1177:Nhsl1 UTSW 10 18526589 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCTATTCACTGGAGGGAAGG -3'
(R):5'- ACCCTCGTTCCAGTGATGAC -3'

Sequencing Primer
(F):5'- AAGGATGGGTGCCCTGG -3'
(R):5'- GGACTGATGGTCATCTTTCACAGAAC -3'
Posted On2016-07-06