Incidental Mutation 'R5258:Mfsd4b2'
ID401251
Institutional Source Beutler Lab
Gene Symbol Mfsd4b2
Ensembl Gene ENSMUSG00000039339
Gene Namemajor facilitator superfamily domain containing 4B2
Synonyms2010001E11Rik
MMRRC Submission 042828-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5258 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location39920382-39926923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39922021 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 113 (M113L)
Ref Sequence ENSEMBL: ENSMUSP00000040384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045526]
Predicted Effect probably benign
Transcript: ENSMUST00000045526
AA Change: M113L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040384
Gene: ENSMUSG00000039339
AA Change: M113L

DomainStartEndE-ValueType
Pfam:MFS_1 1 322 3.9e-11 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,333 probably benign Het
3425401B19Rik T A 14: 32,663,309 D233V probably damaging Het
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Abcc8 T C 7: 46,108,387 I1313V probably benign Het
Abcc8 C T 7: 46,157,148 V379I probably benign Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
B3gnt7 A G 1: 86,305,565 K61E possibly damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Cd1d2 C G 3: 86,987,647 R147G possibly damaging Het
Cfap69 T C 5: 5,604,271 probably null Het
Ddx46 T C 13: 55,653,024 F331L possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gm12887 T C 4: 121,615,700 K82E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Invs A G 4: 48,396,374 D349G possibly damaging Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Lipo3 T A 19: 33,613,843 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Map3k6 T C 4: 133,247,642 V662A possibly damaging Het
Megf8 T A 7: 25,348,326 F1645I possibly damaging Het
Mib1 G A 18: 10,795,856 probably null Het
Mrps6 T A 16: 92,099,655 V36E probably damaging Het
Nhsl1 C A 10: 18,524,322 S432* probably null Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Nlrp4c T A 7: 6,066,623 S508T probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1164 A T 2: 88,093,418 Y173N probably benign Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptprg A G 14: 12,142,431 T361A probably benign Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tas2r114 T A 6: 131,689,541 I175F probably benign Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Trav14-1 C T 14: 53,554,273 H27Y probably benign Het
Trim24 A T 6: 37,919,400 Q264L probably damaging Het
Vmn2r90 A G 17: 17,712,852 I225V probably benign Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp407 C T 18: 84,315,926 V1761I probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Mfsd4b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Mfsd4b2 APN 10 39925061 splice site probably benign
IGL01546:Mfsd4b2 APN 10 39921475 missense probably damaging 1.00
IGL01662:Mfsd4b2 APN 10 39922197 splice site probably benign
IGL02151:Mfsd4b2 APN 10 39921691 missense probably damaging 1.00
R1928:Mfsd4b2 UTSW 10 39921462 missense probably damaging 1.00
R2851:Mfsd4b2 UTSW 10 39922123 missense probably benign 0.07
R3777:Mfsd4b2 UTSW 10 39921531 missense possibly damaging 0.54
R5055:Mfsd4b2 UTSW 10 39923777 missense possibly damaging 0.79
R5257:Mfsd4b2 UTSW 10 39922021 missense probably benign 0.00
R5563:Mfsd4b2 UTSW 10 39922042 missense probably benign 0.15
R5728:Mfsd4b2 UTSW 10 39923795 missense possibly damaging 0.47
R5888:Mfsd4b2 UTSW 10 39922035 missense probably benign 0.00
R6147:Mfsd4b2 UTSW 10 39921577 missense probably benign
R6362:Mfsd4b2 UTSW 10 39921609 missense probably damaging 1.00
R7462:Mfsd4b2 UTSW 10 39921881 missense probably benign 0.03
R7801:Mfsd4b2 UTSW 10 39923781 missense probably benign 0.00
R8126:Mfsd4b2 UTSW 10 39921988 missense probably benign
R8158:Mfsd4b2 UTSW 10 39922068 missense probably benign 0.35
Z1176:Mfsd4b2 UTSW 10 39921600 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAGCCGTATGTTATCTCAGCTCC -3'
(R):5'- GGAACGTCCTCATCTTGGATC -3'

Sequencing Primer
(F):5'- CAGGGCCCTGTGATATTTAGCC -3'
(R):5'- GAACGTCCTCATCTTGGATCTCTGG -3'
Posted On2016-07-06