Incidental Mutation 'R5258:Tex2'
ID401259
Institutional Source Beutler Lab
Gene Symbol Tex2
Ensembl Gene ENSMUSG00000040548
Gene Nametestis expressed gene 2
SynonymsDef-5, Taz4, 4930568E07Rik
MMRRC Submission 042828-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5258 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106502147-106613423 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 106567759 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000042780] [ENSMUST00000103070] [ENSMUST00000128933] [ENSMUST00000153870]
Predicted Effect unknown
Transcript: ENSMUST00000042780
AA Change: M282L
SMART Domains Protein: ENSMUSP00000041985
Gene: ENSMUSG00000040548
AA Change: M282L

DomainStartEndE-ValueType
low complexity region 119 186 N/A INTRINSIC
low complexity region 319 341 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
PH 543 712 5.05e-1 SMART
low complexity region 732 752 N/A INTRINSIC
low complexity region 811 823 N/A INTRINSIC
low complexity region 946 965 N/A INTRINSIC
low complexity region 1003 1016 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000103070
AA Change: M282L
SMART Domains Protein: ENSMUSP00000099359
Gene: ENSMUSG00000040548
AA Change: M282L

DomainStartEndE-ValueType
low complexity region 119 186 N/A INTRINSIC
low complexity region 319 341 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
PH 543 712 5.05e-1 SMART
low complexity region 732 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128933
SMART Domains Protein: ENSMUSP00000120781
Gene: ENSMUSG00000040548

DomainStartEndE-ValueType
low complexity region 119 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153870
Predicted Effect probably benign
Transcript: ENSMUST00000207249
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,333 probably benign Het
3425401B19Rik T A 14: 32,663,309 D233V probably damaging Het
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Abcc8 T C 7: 46,108,387 I1313V probably benign Het
Abcc8 C T 7: 46,157,148 V379I probably benign Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
B3gnt7 A G 1: 86,305,565 K61E possibly damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Cd1d2 C G 3: 86,987,647 R147G possibly damaging Het
Cfap69 T C 5: 5,604,271 probably null Het
Ddx46 T C 13: 55,653,024 F331L possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gm12887 T C 4: 121,615,700 K82E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Invs A G 4: 48,396,374 D349G possibly damaging Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Lipo3 T A 19: 33,613,843 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Map3k6 T C 4: 133,247,642 V662A possibly damaging Het
Megf8 T A 7: 25,348,326 F1645I possibly damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mib1 G A 18: 10,795,856 probably null Het
Mrps6 T A 16: 92,099,655 V36E probably damaging Het
Nhsl1 C A 10: 18,524,322 S432* probably null Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Nlrp4c T A 7: 6,066,623 S508T probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1164 A T 2: 88,093,418 Y173N probably benign Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptprg A G 14: 12,142,431 T361A probably benign Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tas2r114 T A 6: 131,689,541 I175F probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Trav14-1 C T 14: 53,554,273 H27Y probably benign Het
Trim24 A T 6: 37,919,400 Q264L probably damaging Het
Vmn2r90 A G 17: 17,712,852 I225V probably benign Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp407 C T 18: 84,315,926 V1761I probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Tex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tex2 APN 11 106568535 missense probably damaging 1.00
IGL01380:Tex2 APN 11 106544315 nonsense probably null
IGL02607:Tex2 APN 11 106546747 missense unknown
IGL02680:Tex2 APN 11 106568232 unclassified probably benign
IGL02699:Tex2 APN 11 106568433 missense possibly damaging 0.53
IGL03187:Tex2 APN 11 106568077 unclassified probably benign
IGL03398:Tex2 APN 11 106568272 missense probably damaging 1.00
R0242:Tex2 UTSW 11 106519955 nonsense probably null
R0242:Tex2 UTSW 11 106519955 nonsense probably null
R1085:Tex2 UTSW 11 106568487 missense probably damaging 0.98
R1491:Tex2 UTSW 11 106503640 missense possibly damaging 0.72
R1664:Tex2 UTSW 11 106567782 unclassified probably benign
R1794:Tex2 UTSW 11 106567902 unclassified probably benign
R1855:Tex2 UTSW 11 106546876 missense possibly damaging 0.87
R2077:Tex2 UTSW 11 106506864 splice site probably null
R2151:Tex2 UTSW 11 106567335 unclassified probably benign
R2175:Tex2 UTSW 11 106503687 missense unknown
R2984:Tex2 UTSW 11 106546663 critical splice donor site probably null
R3156:Tex2 UTSW 11 106533869 critical splice donor site probably null
R3722:Tex2 UTSW 11 106546740 nonsense probably null
R3724:Tex2 UTSW 11 106529330 missense unknown
R3770:Tex2 UTSW 11 106544252 missense unknown
R3771:Tex2 UTSW 11 106546894 missense unknown
R3813:Tex2 UTSW 11 106511944 missense unknown
R3947:Tex2 UTSW 11 106520003 missense unknown
R4206:Tex2 UTSW 11 106567572 unclassified probably benign
R4342:Tex2 UTSW 11 106567006 unclassified probably benign
R4554:Tex2 UTSW 11 106544386 missense unknown
R4896:Tex2 UTSW 11 106568404 missense probably damaging 1.00
R5207:Tex2 UTSW 11 106546840 missense unknown
R5249:Tex2 UTSW 11 106546789 missense unknown
R5257:Tex2 UTSW 11 106567759 unclassified probably benign
R5278:Tex2 UTSW 11 106567813 missense probably benign 0.34
R5702:Tex2 UTSW 11 106544395 missense possibly damaging 0.58
R5835:Tex2 UTSW 11 106519913 missense unknown
R6150:Tex2 UTSW 11 106567080 missense probably benign 0.34
R6785:Tex2 UTSW 11 106533950 missense probably damaging 1.00
R6879:Tex2 UTSW 11 106534010 missense unknown
R7038:Tex2 UTSW 11 106511900 critical splice donor site probably null
R7117:Tex2 UTSW 11 106544245 missense unknown
R7336:Tex2 UTSW 11 106548859 missense unknown
R7568:Tex2 UTSW 11 106548736 missense unknown
R7622:Tex2 UTSW 11 106546895 missense unknown
R8228:Tex2 UTSW 11 106567171 missense probably benign 0.34
T0970:Tex2 UTSW 11 106546946 missense unknown
Z1177:Tex2 UTSW 11 106534008 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTTATTGCTTTCCAAGTGCCC -3'
(R):5'- CACAGACACTTGATGAAGACTCTG -3'

Sequencing Primer
(F):5'- TCCAAGTGCCCGTTCAAG -3'
(R):5'- GATGAAGACTCTGGTCAAGTCTC -3'
Posted On2016-07-06