Mutagenetix > Incidental Mutations

Incidental Mutation 'R5258:3425401B19Rik'

401264

Institutional Source

Beutler Lab

Gene Symbol

3425401B19Rik

Ensembl Gene

ENSMUSG00000071540

Gene Name

RIKEN cDNA 3425401B19 gene

Synonyms

MMRRC Submission

042828-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R5258 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32659119-32685293 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32663309 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 233 (D233V)

Ref Sequence

ENSEMBL: ENSMUSP00000093741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096038]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096038
AA Change: D233V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: D233V

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
low complexity region	162	175	N/A	INTRINSIC
low complexity region	386	399	N/A	INTRINSIC
low complexity region	587	602	N/A	INTRINSIC
low complexity region	605	624	N/A	INTRINSIC
low complexity region	728	744	N/A	INTRINSIC
low complexity region	1002	1015	N/A	INTRINSIC
low complexity region	1086	1097	N/A	INTRINSIC
low complexity region	1147	1158	N/A	INTRINSIC
low complexity region	1161	1176	N/A	INTRINSIC
Pfam:DUF4585	1251	1322	6.5e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226958

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

98% (55/56)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	T	C	9: 50,764,333		probably benign	Het
Abca13	A	T	11: 9,249,684	T128S	possibly damaging	Het
Abca16	T	G	7: 120,436,769		probably null	Het
Abcc8	T	C	7: 46,108,387	I1313V	probably benign	Het
Abcc8	C	T	7: 46,157,148	V379I	probably benign	Het
Acpp	T	C	9: 104,309,475	I266V	probably benign	Het
Asf1b	C	T	8: 83,969,267	T179I	probably benign	Het
B3gnt7	A	G	1: 86,305,565	K61E	possibly damaging	Het
Card11	G	A	5: 140,876,425	P1039L	possibly damaging	Het
Cd1d2	C	G	3: 86,987,647	R147G	possibly damaging	Het
Cfap69	T	C	5: 5,604,271		probably null	Het
Ddx46	T	C	13: 55,653,024	F331L	possibly damaging	Het
Dkk4	C	A	8: 22,627,015	L215I	probably damaging	Het
Dnhd1	C	T	7: 105,674,037	T584I	probably benign	Het
Dock3	T	C	9: 106,996,925	Y449C	probably damaging	Het
Foxi2	C	T	7: 135,410,527	T48M	probably benign	Het
Gm12887	T	C	4: 121,615,700	K82E	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Igkv4-80	T	A	6: 69,016,827	T27S	probably benign	Het
Invs	A	G	4: 48,396,374	D349G	possibly damaging	Het
Lbhd1	A	G	19: 8,884,089		probably benign	Het
Lipo3	T	A	19: 33,613,843		probably benign	Het
Llgl1	G	C	11: 60,711,563		probably null	Het
Lyzl6	T	A	11: 103,635,073	I74F	probably damaging	Het
Map3k6	T	C	4: 133,247,642	V662A	possibly damaging	Het
Megf8	T	A	7: 25,348,326	F1645I	possibly damaging	Het
Mfsd4b2	T	A	10: 39,922,021	M113L	probably benign	Het
Mib1	G	A	18: 10,795,856		probably null	Het
Mrps6	T	A	16: 92,099,655	V36E	probably damaging	Het
Nhsl1	C	A	10: 18,524,322	S432*	probably null	Het
Nle1	T	C	11: 82,904,946	D225G	probably damaging	Het
Nlrp4c	T	A	7: 6,066,623	S508T	probably benign	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1164	A	T	2: 88,093,418	Y173N	probably benign	Het
P2rx7	A	G	5: 122,681,003	E496G	probably damaging	Het
Prdm16	A	T	4: 154,367,214	D179E	possibly damaging	Het
Psca	A	T	15: 74,716,391	I56F	probably damaging	Het
Ptprg	A	G	14: 12,142,431	T361A	probably benign	Het
Ptrhd1	A	G	12: 4,236,481	Y124C	probably damaging	Het
Sesn1	C	T	10: 41,894,988	P172S	probably benign	Het
Sspo	T	C	6: 48,476,494	V2872A	probably damaging	Het
Stard9	T	A	2: 120,699,343	L2027H	probably damaging	Het
Tas2r114	T	A	6: 131,689,541	I175F	probably benign	Het
Tex2	T	A	11: 106,567,759		probably benign	Het
Tfdp1	C	T	8: 13,369,529	T86M	possibly damaging	Het
Trav14-1	C	T	14: 53,554,273	H27Y	probably benign	Het
Trim24	A	T	6: 37,919,400	Q264L	probably damaging	Het
Vmn2r90	A	G	17: 17,712,852	I225V	probably benign	Het
Vps13b	A	G	15: 35,794,421	T2326A	possibly damaging	Het
Zfp354b	A	C	11: 50,923,090	I336S	probably benign	Het
Zfp407	C	T	18: 84,315,926	V1761I	probably damaging	Het
Zfp958	A	T	8: 4,628,456	E160D	probably benign	Het

Other mutations in 3425401B19Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:3425401B19Rik	APN	14	32660916	missense	probably benign	0.18
IGL00844:3425401B19Rik	APN	14	32662999	nonsense	probably null
IGL01292:3425401B19Rik	APN	14	32660874	missense	probably benign	0.18
IGL01295:3425401B19Rik	APN	14	32661936	missense	possibly damaging	0.53
IGL01457:3425401B19Rik	APN	14	32660951	missense	probably benign
IGL01470:3425401B19Rik	APN	14	32660457	missense	possibly damaging	0.53
IGL01612:3425401B19Rik	APN	14	32660031	missense	possibly damaging	0.53
IGL01974:3425401B19Rik	APN	14	32659805	missense	possibly damaging	0.85
IGL02095:3425401B19Rik	APN	14	32661626	missense	probably benign	0.33
IGL02138:3425401B19Rik	APN	14	32662715	missense	possibly damaging	0.83
IGL02178:3425401B19Rik	APN	14	32662461	missense	possibly damaging	0.83
IGL02245:3425401B19Rik	APN	14	32659815	missense	probably benign	0.03
IGL02529:3425401B19Rik	APN	14	32661233	missense	probably benign
IGL03401:3425401B19Rik	APN	14	32662266	nonsense	probably null
PIT4515001:3425401B19Rik	UTSW	14	32661111	nonsense	probably null
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0320:3425401B19Rik	UTSW	14	32662614	missense	probably benign	0.19
R0519:3425401B19Rik	UTSW	14	32662962	missense	possibly damaging	0.92
R0551:3425401B19Rik	UTSW	14	32662641	missense	probably benign	0.03
R0759:3425401B19Rik	UTSW	14	32662497	missense	possibly damaging	0.93
R0831:3425401B19Rik	UTSW	14	32662271	missense	probably benign	0.01
R1124:3425401B19Rik	UTSW	14	32662082	missense	possibly damaging	0.53
R1346:3425401B19Rik	UTSW	14	32660814	missense	probably benign	0.07
R1997:3425401B19Rik	UTSW	14	32660048	missense	possibly damaging	0.71
R2055:3425401B19Rik	UTSW	14	32662551	missense	probably benign
R2212:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R2416:3425401B19Rik	UTSW	14	32663834	missense	probably benign	0.04
R2441:3425401B19Rik	UTSW	14	32663492	missense	possibly damaging	0.53
R2513:3425401B19Rik	UTSW	14	32661852	missense	possibly damaging	0.53
R3414:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R3800:3425401B19Rik	UTSW	14	32663068	missense	possibly damaging	0.83
R3809:3425401B19Rik	UTSW	14	32663693	missense	possibly damaging	0.96
R4166:3425401B19Rik	UTSW	14	32660955	missense	possibly damaging	0.53
R4581:3425401B19Rik	UTSW	14	32661871	missense	possibly damaging	0.73
R4721:3425401B19Rik	UTSW	14	32663150	missense	probably benign	0.01
R4769:3425401B19Rik	UTSW	14	32660217	missense	probably benign	0.32
R4809:3425401B19Rik	UTSW	14	32662631	missense	probably benign	0.19
R4919:3425401B19Rik	UTSW	14	32663288	missense	possibly damaging	0.85
R4925:3425401B19Rik	UTSW	14	32663180	missense	possibly damaging	0.86
R4972:3425401B19Rik	UTSW	14	32661404	missense	possibly damaging	0.73
R5068:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5069:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5070:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5435:3425401B19Rik	UTSW	14	32661456	missense	probably benign	0.18
R5549:3425401B19Rik	UTSW	14	32663036	missense	possibly damaging	0.68
R5678:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5680:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5872:3425401B19Rik	UTSW	14	32660352	missense	possibly damaging	0.73
R5896:3425401B19Rik	UTSW	14	32661675	nonsense	probably null
R5940:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6044:3425401B19Rik	UTSW	14	32660657	missense	possibly damaging	0.53
R6136:3425401B19Rik	UTSW	14	32662282	missense	possibly damaging	0.70
R6277:3425401B19Rik	UTSW	14	32663694	missense	possibly damaging	0.86
R6385:3425401B19Rik	UTSW	14	32661279	missense	probably benign	0.01
R6728:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6984:3425401B19Rik	UTSW	14	32661980	missense	probably benign	0.00
R7047:3425401B19Rik	UTSW	14	32660174	missense	possibly damaging	0.89
R7249:3425401B19Rik	UTSW	14	32663314	missense	possibly damaging	0.73
R7493:3425401B19Rik	UTSW	14	32663300	missense	possibly damaging	0.96
R7575:3425401B19Rik	UTSW	14	32662632	missense	probably benign	0.03
R7742:3425401B19Rik	UTSW	14	32662757	missense	possibly damaging	0.68
R7747:3425401B19Rik	UTSW	14	32663069	missense	possibly damaging	0.83
R7784:3425401B19Rik	UTSW	14	32659840	missense	probably benign	0.00
R8098:3425401B19Rik	UTSW	14	32662661	missense	probably damaging	0.99
R8111:3425401B19Rik	UTSW	14	32660309	nonsense	probably null
R8171:3425401B19Rik	UTSW	14	32662025	missense	probably benign
R8276:3425401B19Rik	UTSW	14	32663928	missense	probably damaging	0.97
R8330:3425401B19Rik	UTSW	14	32659793	missense	probably damaging	0.98
R8422:3425401B19Rik	UTSW	14	32662297	missense	possibly damaging	0.84
R8464:3425401B19Rik	UTSW	14	32659977	missense	possibly damaging	0.53
X0025:3425401B19Rik	UTSW	14	32662469	missense	probably damaging	0.98
Z1177:3425401B19Rik	UTSW	14	32659808	missense	possibly damaging	0.86
Z1177:3425401B19Rik	UTSW	14	32661398	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGTGGTTTCAGCAATGTCC -3'
(R):5'- TCAATCTTGTGACAGCCGG -3'

Sequencing Primer
(F):5'- GGTGGTTTCAGCAATGTCCTTTCTC -3'
(R):5'- GCCTCCGGCTCTCAAAAATC -3'

Posted On

2016-07-06