Incidental Mutation 'R5258:Vmn2r90'
ID401269
Institutional Source Beutler Lab
Gene Symbol Vmn2r90
Ensembl Gene ENSMUSG00000092120
Gene Namevomeronasal 2, receptor 90
SynonymsEG626942
MMRRC Submission 042828-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5258 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location17703747-17735156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17712852 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 225 (I225V)
Ref Sequence ENSEMBL: ENSMUSP00000126650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169805] [ENSMUST00000231659] [ENSMUST00000232078] [ENSMUST00000232113]
Predicted Effect probably benign
Transcript: ENSMUST00000169805
AA Change: I225V

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126650
Gene: ENSMUSG00000092120
AA Change: I225V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-43 PFAM
Pfam:NCD3G 514 567 3e-22 PFAM
Pfam:7tm_3 600 835 9.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231659
Predicted Effect probably benign
Transcript: ENSMUST00000232078
Predicted Effect probably benign
Transcript: ENSMUST00000232113
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,333 probably benign Het
3425401B19Rik T A 14: 32,663,309 D233V probably damaging Het
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Abcc8 T C 7: 46,108,387 I1313V probably benign Het
Abcc8 C T 7: 46,157,148 V379I probably benign Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
B3gnt7 A G 1: 86,305,565 K61E possibly damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Cd1d2 C G 3: 86,987,647 R147G possibly damaging Het
Cfap69 T C 5: 5,604,271 probably null Het
Ddx46 T C 13: 55,653,024 F331L possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gm12887 T C 4: 121,615,700 K82E probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Invs A G 4: 48,396,374 D349G possibly damaging Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Lipo3 T A 19: 33,613,843 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Map3k6 T C 4: 133,247,642 V662A possibly damaging Het
Megf8 T A 7: 25,348,326 F1645I possibly damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mib1 G A 18: 10,795,856 probably null Het
Mrps6 T A 16: 92,099,655 V36E probably damaging Het
Nhsl1 C A 10: 18,524,322 S432* probably null Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Nlrp4c T A 7: 6,066,623 S508T probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1164 A T 2: 88,093,418 Y173N probably benign Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptprg A G 14: 12,142,431 T361A probably benign Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tas2r114 T A 6: 131,689,541 I175F probably benign Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Trav14-1 C T 14: 53,554,273 H27Y probably benign Het
Trim24 A T 6: 37,919,400 Q264L probably damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Zfp407 C T 18: 84,315,926 V1761I probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Vmn2r90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Vmn2r90 APN 17 17733496 missense probably benign 0.00
IGL01330:Vmn2r90 APN 17 17733280 missense probably benign 0.00
IGL01989:Vmn2r90 APN 17 17713232 nonsense probably null
IGL02080:Vmn2r90 APN 17 17712858 missense probably damaging 1.00
IGL02112:Vmn2r90 APN 17 17712203 missense probably damaging 0.98
IGL02123:Vmn2r90 APN 17 17733482 missense probably benign 0.01
IGL02749:Vmn2r90 APN 17 17726860 makesense probably null
IGL03114:Vmn2r90 APN 17 17733509 missense probably damaging 1.00
R0131:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0131:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0132:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0184:Vmn2r90 UTSW 17 17726877 nonsense probably null
R0379:Vmn2r90 UTSW 17 17728139 missense probably damaging 1.00
R1022:Vmn2r90 UTSW 17 17728138 missense probably damaging 1.00
R1024:Vmn2r90 UTSW 17 17728138 missense probably damaging 1.00
R1897:Vmn2r90 UTSW 17 17733304 missense probably damaging 1.00
R1993:Vmn2r90 UTSW 17 17713263 missense probably damaging 1.00
R2472:Vmn2r90 UTSW 17 17728146 missense probably damaging 1.00
R2508:Vmn2r90 UTSW 17 17733967 missense probably damaging 1.00
R2679:Vmn2r90 UTSW 17 17712869 missense possibly damaging 0.46
R3409:Vmn2r90 UTSW 17 17733376 missense probably benign 0.00
R4693:Vmn2r90 UTSW 17 17733694 missense possibly damaging 0.91
R4797:Vmn2r90 UTSW 17 17712305 missense probably damaging 1.00
R5358:Vmn2r90 UTSW 17 17704150 critical splice donor site probably null
R5445:Vmn2r90 UTSW 17 17734124 missense probably benign 0.04
R5446:Vmn2r90 UTSW 17 17712202 missense probably damaging 0.99
R5567:Vmn2r90 UTSW 17 17712074 missense probably damaging 1.00
R5680:Vmn2r90 UTSW 17 17726772 missense possibly damaging 0.93
R5686:Vmn2r90 UTSW 17 17713450 missense probably benign 0.02
R5751:Vmn2r90 UTSW 17 17733866 missense probably damaging 0.96
R6156:Vmn2r90 UTSW 17 17733344 missense probably benign 0.01
R6185:Vmn2r90 UTSW 17 17733382 missense probably damaging 1.00
R6450:Vmn2r90 UTSW 17 17733236 missense possibly damaging 0.47
R6707:Vmn2r90 UTSW 17 17728102 missense probably damaging 1.00
R6802:Vmn2r90 UTSW 17 17712089 missense probably damaging 1.00
R6913:Vmn2r90 UTSW 17 17704061 missense probably damaging 1.00
R7070:Vmn2r90 UTSW 17 17704051 missense probably damaging 0.98
R7237:Vmn2r90 UTSW 17 17703987 missense possibly damaging 0.92
R7503:Vmn2r90 UTSW 17 17713248 missense not run
R7698:Vmn2r90 UTSW 17 17733334 missense probably benign
R8072:Vmn2r90 UTSW 17 17726880 missense probably damaging 1.00
R8128:Vmn2r90 UTSW 17 17733893 missense probably damaging 1.00
R8295:Vmn2r90 UTSW 17 17728096 missense probably benign 0.03
Z1088:Vmn2r90 UTSW 17 17733617 missense probably damaging 1.00
Z1176:Vmn2r90 UTSW 17 17712817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCCAATATTCTTGCCCTTG -3'
(R):5'- CTGTGCAATATGTCGCATTAAACC -3'

Sequencing Primer
(F):5'- GTATCCAATTTTGTTTTCTGCAGC -3'
(R):5'- GTCGCATTAAACCTTGTAGAGAAAC -3'
Posted On2016-07-06