Incidental Mutation 'R5259:Ddx18'
ID401279
Institutional Source Beutler Lab
Gene Symbol Ddx18
Ensembl Gene ENSMUSG00000001674
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R5259 (G1)
Quality Score170
Status Validated
Chromosome1
Chromosomal Location121553835-121567989 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 121567789 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001724]
Predicted Effect probably null
Transcript: ENSMUST00000001724
SMART Domains Protein: ENSMUSP00000001724
Gene: ENSMUSG00000001674

DomainStartEndE-ValueType
coiled coil region 2 32 N/A INTRINSIC
internal_repeat_1 36 75 1.67e-5 PROSPERO
internal_repeat_1 66 105 1.67e-5 PROSPERO
low complexity region 109 117 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
DEXDc 188 393 1.95e-56 SMART
low complexity region 401 417 N/A INTRINSIC
HELICc 429 510 2.84e-26 SMART
DUF4217 550 613 1.65e-26 SMART
low complexity region 620 638 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131471
Meta Mutation Damage Score 0.9381 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Ddx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Ddx18 APN 1 121564586 missense probably benign 0.00
IGL01999:Ddx18 APN 1 121561728 missense probably benign 0.19
IGL03056:Ddx18 APN 1 121564535 missense probably benign 0.00
IGL03388:Ddx18 APN 1 121565923 missense possibly damaging 0.86
R0550:Ddx18 UTSW 1 121555375 missense probably benign 0.40
R1883:Ddx18 UTSW 1 121567916 start gained probably benign
R1940:Ddx18 UTSW 1 121555224 missense probably damaging 1.00
R2169:Ddx18 UTSW 1 121558409 critical splice donor site probably null
R3113:Ddx18 UTSW 1 121566148 missense possibly damaging 0.65
R3414:Ddx18 UTSW 1 121562149 missense probably benign
R3763:Ddx18 UTSW 1 121561377 missense probably damaging 0.99
R4011:Ddx18 UTSW 1 121562081 missense probably benign 0.01
R4293:Ddx18 UTSW 1 121561392 missense probably benign 0.10
R4333:Ddx18 UTSW 1 121564602 missense probably benign 0.01
R4964:Ddx18 UTSW 1 121566094 missense probably benign 0.00
R5160:Ddx18 UTSW 1 121565879 critical splice donor site probably null
R5187:Ddx18 UTSW 1 121562128 missense probably damaging 0.98
R5656:Ddx18 UTSW 1 121561358 missense probably damaging 1.00
R7949:Ddx18 UTSW 1 121555318 missense probably damaging 1.00
R8291:Ddx18 UTSW 1 121560175 missense probably damaging 0.99
R8318:Ddx18 UTSW 1 121566087 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCACCCTGAGTCGAGAAAGC -3'
(R):5'- GGAAATTCGGTCTCCAAAGGG -3'

Sequencing Primer
(F):5'- CTGAGTCGAGAAAGCCACGC -3'
(R):5'- AACTGTTTCCGCCCGAAG -3'
Posted On2016-07-06