Mutagenetix > Incidental Mutation

Incidental Mutation 'R5259:Gm4788'

401281

Institutional Source

Beutler Lab

Gene Symbol

Gm4788

Ensembl Gene

ENSMUSG00000070594

Gene Name

predicted gene 4788

Synonyms

MMRRC Submission

042856-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R5259 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139697623-139781243 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 139740495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 300 (C300Y)

Ref Sequence

ENSEMBL: ENSMUSP00000107617 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027612] [ENSMUST00000111986] [ENSMUST00000111989]

AlphaFold

E9Q8B5

Predicted Effect

probably damaging
Transcript: ENSMUST00000027612
AA Change: C300Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027612
Gene: ENSMUSG00000070594
AA Change: C300Y

Domain	Start	End	E-Value	Type
CCP	28	88	1.65e-2	SMART
CCP	92	145	1.15e-10	SMART
CCP	151	208	5.65e-10	SMART
CCP	212	267	1.12e-4	SMART
CCP	272	325	4.52e-9	SMART
CCP	332	386	9.1e-14	SMART
CCP	393	446	1.58e-13	SMART
CCP	455	505	4.92e-1	SMART
CCP	511	564	8.9e-8	SMART
CCP	569	622	4.18e-13	SMART
CCP	627	681	3.5e-15	SMART
CCP	688	742	5.69e-15	SMART
CCP	746	807	2.77e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111986
AA Change: C300Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107617
Gene: ENSMUSG00000070594
AA Change: C300Y

Domain	Start	End	E-Value	Type
CCP	28	88	1.65e-2	SMART
CCP	92	145	1.15e-10	SMART
CCP	151	208	5.65e-10	SMART
CCP	212	267	1.12e-4	SMART
CCP	272	325	4.52e-9	SMART
CCP	333	387	9.1e-14	SMART
CCP	394	447	1.58e-13	SMART
CCP	456	506	4.92e-1	SMART
CCP	512	565	8.9e-8	SMART
CCP	571	635	2.66e-6	SMART
CCP	640	693	4.18e-13	SMART
CCP	700	754	5.69e-15	SMART
CCP	758	819	2.77e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111989
AA Change: C300Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107620
Gene: ENSMUSG00000070594
AA Change: C300Y

Domain	Start	End	E-Value	Type
CCP	28	88	1.65e-2	SMART
CCP	92	145	1.15e-10	SMART
CCP	151	208	5.65e-10	SMART
CCP	212	267	1.12e-4	SMART
CCP	272	325	4.52e-9	SMART
CCP	333	387	9.1e-14	SMART
CCP	394	447	1.58e-13	SMART
CCP	456	506	4.92e-1	SMART
CCP	512	565	8.9e-8	SMART
CCP	571	635	2.66e-6	SMART
CCP	640	693	4.18e-13	SMART
CCP	698	752	3.5e-15	SMART
CCP	759	813	5.69e-15	SMART
CCP	817	878	2.77e0	SMART

Meta Mutation Damage Score

0.8958

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

100% (68/68)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	T	C	8: 45,962,336	E211G	probably benign	Het
2310035C23Rik	A	G	1: 105,721,376	S747G	probably benign	Het
Abhd18	A	C	3: 40,916,890	T50P	probably damaging	Het
Adam5	T	A	8: 24,810,834	L226F	possibly damaging	Het
Adi1	T	C	12: 28,675,545		probably benign	Het
Apc	T	C	18: 34,314,290	V1379A	probably benign	Het
Atp13a4	G	A	16: 29,456,610	T352M	probably damaging	Het
Baat	T	A	4: 49,490,070	N338I	probably benign	Het
Bdnf	A	G	2: 109,723,982	T234A	probably benign	Het
Catsperd	A	C	17: 56,660,235	T539P	possibly damaging	Het
Cd109	A	T	9: 78,710,152	T1311S	probably benign	Het
Ceacam18	T	C	7: 43,637,112		probably null	Het
Chsy3	T	A	18: 59,410,246	S819T	probably damaging	Het
Col4a4	G	T	1: 82,453,893	R1557S	unknown	Het
Ddx18	A	G	1: 121,567,789		probably null	Het
Depdc5	C	T	5: 32,938,291	P824L	probably damaging	Het
Fam13c	C	G	10: 70,441,063	A17G	probably benign	Het
Fermt1	T	C	2: 132,906,765	Y646C	probably damaging	Het
Fra10ac1	A	G	19: 38,199,662	S229P	probably benign	Het
Gbp8	A	T	5: 105,050,979	H23Q	probably benign	Het
Gdf2	T	C	14: 33,944,831	V170A	probably benign	Het
Gm15723	T	C	10: 114,816,817		noncoding transcript	Het
Gm5415	A	T	1: 32,545,517	C437*	probably null	Het
Gm815	G	A	19: 26,886,406	V16I	unknown	Het
Ighv1-75	T	A	12: 115,834,177	K42*	probably null	Het
Isx	A	G	8: 74,892,845	T222A	probably benign	Het
Itgax	G	A	7: 128,148,278	D1018N	probably damaging	Het
Kcnc4	A	G	3: 107,448,085	F349S	probably damaging	Het
Lama3	A	C	18: 12,465,508	S991R	probably damaging	Het
Larp4b	C	T	13: 9,158,184	A398V	probably damaging	Het
Ltbp1	A	G	17: 75,363,362	N1466S	probably benign	Het
Metrn	A	T	17: 25,796,540	L67Q	probably damaging	Het
Morc1	G	A	16: 48,630,769	R937Q	probably benign	Het
Mta3	A	G	17: 83,804,574	Y577C	probably damaging	Het
Nalcn	A	G	14: 123,515,651	F308L	possibly damaging	Het
Nat8	A	T	6: 85,830,891	S87T	probably benign	Het
Olfr319	A	G	11: 58,701,952	N84D	probably benign	Het
Olfr319	A	C	11: 58,701,953	N84T	possibly damaging	Het
Olfr857	A	G	9: 19,712,813		probably null	Het
Oplah	A	T	15: 76,301,210		probably null	Het
Pcdh15	A	T	10: 74,396,372	I668L	possibly damaging	Het
Pecr	A	G	1: 72,277,285		probably null	Het
Plxna4	T	C	6: 32,517,021	E220G	possibly damaging	Het
Pnmal2	A	G	7: 16,945,274	K61R	unknown	Het
Prl8a6	C	T	13: 27,436,196	W81*	probably null	Het
Rab33b	C	T	3: 51,484,612		probably benign	Het
Rbm33	T	A	5: 28,352,774		probably null	Het
Reln	C	T	5: 22,103,397	V325M	possibly damaging	Het
Rheb	A	C	5: 24,803,745	D158E	probably benign	Het
Rhebl1	T	A	15: 98,880,583		probably benign	Het
Rmdn2	T	A	17: 79,668,017	Y312N	probably damaging	Het
Scamp1	T	G	13: 94,232,086	N58T	probably benign	Het
Slc35a1	C	T	4: 34,683,322	V53M	probably benign	Het
Slc35f3	A	T	8: 126,389,133	L266F	probably damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Ticrr	T	A	7: 79,694,723	S1445R	probably benign	Het
Ttc23l	T	C	15: 10,515,150	N381D	probably damaging	Het
Usp17ld	T	A	7: 103,250,574	K384*	probably null	Het
Vmn1r20	T	A	6: 57,432,065	Y125*	probably null	Het
Zfp738	G	T	13: 67,669,686	Q729K	probably benign	Het
Zfp770	T	A	2: 114,197,193	M132L	probably benign	Het

Other mutations in Gm4788

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00906:Gm4788	APN	1	139731574	missense	probably damaging	0.99
IGL01088:Gm4788	APN	1	139698085	utr 3 prime	probably benign
IGL01419:Gm4788	APN	1	139739644	critical splice acceptor site	probably null
IGL01552:Gm4788	APN	1	139739302	missense	probably damaging	1.00
IGL01924:Gm4788	APN	1	139739206	missense	probably damaging	0.99
IGL02032:Gm4788	APN	1	139774546	missense	probably damaging	1.00
IGL02254:Gm4788	APN	1	139733405	splice site	probably benign
IGL02318:Gm4788	APN	1	139781097	missense	probably benign	0.20
IGL02527:Gm4788	APN	1	139753045	missense	probably damaging	1.00
IGL02531:Gm4788	APN	1	139774569	missense	probably benign	0.10
IGL02587:Gm4788	APN	1	139701930	missense	probably damaging	1.00
IGL02644:Gm4788	APN	1	139781167	start codon destroyed	probably null	0.63
IGL02852:Gm4788	APN	1	139774016	missense	probably damaging	1.00
IGL02963:Gm4788	APN	1	139731596	nonsense	probably null
IGL03084:Gm4788	APN	1	139781142	missense	possibly damaging	0.94
R0131:Gm4788	UTSW	1	139754271	missense	probably damaging	0.98
R0131:Gm4788	UTSW	1	139754271	missense	probably damaging	0.98
R0132:Gm4788	UTSW	1	139754271	missense	probably damaging	0.98
R0549:Gm4788	UTSW	1	139739488	missense	probably damaging	1.00
R0558:Gm4788	UTSW	1	139739492	missense	probably damaging	0.99
R0610:Gm4788	UTSW	1	139701846	missense	probably benign	0.20
R1341:Gm4788	UTSW	1	139732393	missense	probably damaging	0.98
R1460:Gm4788	UTSW	1	139698196	missense	probably damaging	0.99
R1544:Gm4788	UTSW	1	139736870	missense	probably damaging	1.00
R1873:Gm4788	UTSW	1	139774660	missense	probably damaging	0.97
R2032:Gm4788	UTSW	1	139733255	splice site	probably benign
R2111:Gm4788	UTSW	1	139774679	splice site	probably benign
R2179:Gm4788	UTSW	1	139731541	missense	probably damaging	1.00
R3806:Gm4788	UTSW	1	139753035	missense	probably damaging	1.00
R4356:Gm4788	UTSW	1	139732310	missense	probably damaging	1.00
R4747:Gm4788	UTSW	1	139698184	missense	probably damaging	1.00
R4838:Gm4788	UTSW	1	139733443	missense	probably damaging	1.00
R4867:Gm4788	UTSW	1	139774475	critical splice donor site	probably null
R4910:Gm4788	UTSW	1	139774563	missense	probably damaging	1.00
R4911:Gm4788	UTSW	1	139774563	missense	probably damaging	1.00
R5050:Gm4788	UTSW	1	139736840	missense	probably damaging	0.99
R5120:Gm4788	UTSW	1	139753103	missense	probably benign	0.39
R5504:Gm4788	UTSW	1	139701820	missense	probably benign	0.18
R5825:Gm4788	UTSW	1	139774598	splice site	probably null
R5949:Gm4788	UTSW	1	139733149	missense	probably damaging	0.98
R6140:Gm4788	UTSW	1	139732395	missense	probably damaging	1.00
R6200:Gm4788	UTSW	1	139754335	missense	probably damaging	0.97
R6254:Gm4788	UTSW	1	139754390	missense	probably damaging	0.98
R6255:Gm4788	UTSW	1	139753011	nonsense	probably null
R6334:Gm4788	UTSW	1	139773924	splice site	probably null
R6611:Gm4788	UTSW	1	139732390	missense	probably damaging	1.00
R6798:Gm4788	UTSW	1	139698121	missense	probably benign	0.20
R6800:Gm4788	UTSW	1	139701981	missense	possibly damaging	0.85
R6895:Gm4788	UTSW	1	139740472	missense	possibly damaging	0.84
R6904:Gm4788	UTSW	1	139731653	missense	possibly damaging	0.79
R6994:Gm4788	UTSW	1	139736930	missense	possibly damaging	0.67
R7173:Gm4788	UTSW	1	139731677	nonsense	probably null
R7184:Gm4788	UTSW	1	139733084	missense	possibly damaging	0.65
R7192:Gm4788	UTSW	1	139739295	missense	probably damaging	0.96
R7205:Gm4788	UTSW	1	139753050	nonsense	probably null
R7302:Gm4788	UTSW	1	139739698	splice site	probably null
R7308:Gm4788	UTSW	1	139754303	missense	possibly damaging	0.71
R7735:Gm4788	UTSW	1	139732301	critical splice donor site	probably null
R8006:Gm4788	UTSW	1	139736852	missense	probably damaging	1.00
R8045:Gm4788	UTSW	1	139733505	missense	probably damaging	0.99
R8188:Gm4788	UTSW	1	139698130	missense	probably damaging	1.00
R8339:Gm4788	UTSW	1	139732419	missense	probably damaging	1.00
R9156:Gm4788	UTSW	1	139732347	missense	probably damaging	0.96
R9339:Gm4788	UTSW	1	139754306	missense	probably benign	0.26
R9520:Gm4788	UTSW	1	139754397	missense	probably damaging	0.99
R9525:Gm4788	UTSW	1	139774512	missense	probably damaging	1.00
R9554:Gm4788	UTSW	1	139740431	missense	probably benign	0.04
X0009:Gm4788	UTSW	1	139733549	missense	probably benign	0.08
X0024:Gm4788	UTSW	1	139733509	missense	probably damaging	1.00
Z1088:Gm4788	UTSW	1	139754261	missense	probably damaging	0.99
Z1176:Gm4788	UTSW	1	139698256	missense	probably benign	0.13
Z1176:Gm4788	UTSW	1	139733448	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTGTGTATTGGTCACATAAAAC -3'
(R):5'- AGCTTTCCTGTGAATGTACTTGAG -3'

Sequencing Primer
(F):5'- CATGGATGTCAATTTCCCTGAAG -3'
(R):5'- TGCAGCGTTCCCATTCTA -3'

Posted On

2016-07-06