Incidental Mutation 'R5259:Bdnf'
ID401282
Institutional Source Beutler Lab
Gene Symbol Bdnf
Ensembl Gene ENSMUSG00000048482
Gene Namebrain derived neurotrophic factor
Synonyms
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R5259 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location109674700-109727007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109723982 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 234 (T234A)
Ref Sequence ENSEMBL: ENSMUSP00000106671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053317] [ENSMUST00000111042] [ENSMUST00000111043] [ENSMUST00000111044] [ENSMUST00000111045] [ENSMUST00000111046] [ENSMUST00000111047] [ENSMUST00000111049] [ENSMUST00000111050] [ENSMUST00000111051] [ENSMUST00000176893]
Predicted Effect probably benign
Transcript: ENSMUST00000053317
AA Change: T202A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057989
Gene: ENSMUSG00000048482
AA Change: T202A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
NGF 143 250 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111042
AA Change: T234A

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106671
Gene: ENSMUSG00000048482
AA Change: T234A

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
NGF 175 282 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111043
AA Change: T194A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106672
Gene: ENSMUSG00000048482
AA Change: T194A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111044
AA Change: T194A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106673
Gene: ENSMUSG00000048482
AA Change: T194A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111045
AA Change: T194A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106674
Gene: ENSMUSG00000048482
AA Change: T194A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111046
AA Change: T194A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106675
Gene: ENSMUSG00000048482
AA Change: T194A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111047
AA Change: T194A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106676
Gene: ENSMUSG00000048482
AA Change: T194A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111049
AA Change: T194A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106678
Gene: ENSMUSG00000048482
AA Change: T194A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111050
AA Change: T194A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106679
Gene: ENSMUSG00000048482
AA Change: T194A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111051
AA Change: T194A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106680
Gene: ENSMUSG00000048482
AA Change: T194A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176893
AA Change: T194A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135762
Gene: ENSMUSG00000048482
AA Change: T194A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Meta Mutation Damage Score 0.0796 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the nerve growth factor family. It is involved in the growth, differentiation and survival of specific types of developing neurons both in the central nervous system (CNS) and the peripheral nervous system. It is also involved in regulating synaptic plasticity in the CNS. Expression of a similar gene in human is reduced in both Alzheimer's and Huntington disease patients. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for targeted null alleles exhibit sensory neuron losses affecting coordination, balance, hearing, taste, and breathing, cerebellar abnormalities, increased sympathetic neuron number, and postnatal lethality. Carriers show mild defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Bdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Bdnf APN 2 109723547 missense probably benign 0.02
IGL01285:Bdnf APN 2 109723586 missense probably benign 0.02
IGL01595:Bdnf APN 2 109723928 nonsense probably null
IGL01737:Bdnf APN 2 109723755 missense probably damaging 1.00
IGL02450:Bdnf APN 2 109723604 missense possibly damaging 0.75
IGL02793:Bdnf APN 2 109723851 missense probably damaging 1.00
IGL02875:Bdnf APN 2 109723851 missense probably damaging 1.00
R0505:Bdnf UTSW 2 109675343 splice site probably null
R0626:Bdnf UTSW 2 109723538 missense probably benign 0.01
R0792:Bdnf UTSW 2 109724118 missense probably damaging 1.00
R1568:Bdnf UTSW 2 109723794 missense probably damaging 1.00
R2066:Bdnf UTSW 2 109723902 missense probably damaging 1.00
R4704:Bdnf UTSW 2 109723692 missense possibly damaging 0.89
R5000:Bdnf UTSW 2 109723648 missense probably benign 0.01
R5301:Bdnf UTSW 2 109723539 missense probably benign
R6344:Bdnf UTSW 2 109723677 missense probably benign 0.01
R7392:Bdnf UTSW 2 109723930 missense probably benign 0.01
X0028:Bdnf UTSW 2 109723883 missense possibly damaging 0.77
X0058:Bdnf UTSW 2 109723637 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGTCTATGAGGGTTCGGC -3'
(R):5'- TGTGCGCAAATGACTGTTTCC -3'

Sequencing Primer
(F):5'- TATGAGGGTTCGGCGCCAC -3'
(R):5'- GCAAATGACTGTTTCCTTTCAGG -3'
Posted On2016-07-06