Incidental Mutation 'R5259:Zfp770'
ID401283
Institutional Source Beutler Lab
Gene Symbol Zfp770
Ensembl Gene ENSMUSG00000040321
Gene Namezinc finger protein 770
Synonyms6430601A21Rik
MMRRC Submission 042856-MU
Accession Numbers

Ncbi RefSeq: NM_175466.4; MGI: 2445100

Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5259 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location114193461-114201469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114197193 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 132 (M132L)
Ref Sequence ENSEMBL: ENSMUSP00000052194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050668]
Predicted Effect probably benign
Transcript: ENSMUST00000050668
AA Change: M132L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052194
Gene: ENSMUSG00000040321
AA Change: M132L

DomainStartEndE-ValueType
ZnF_C2H2 31 53 1.18e-2 SMART
ZnF_C2H2 59 81 4.11e-2 SMART
ZnF_C2H2 85 107 3.58e-2 SMART
ZnF_C2H2 164 186 2.09e-3 SMART
ZnF_C2H2 192 214 3.58e-2 SMART
ZnF_C2H2 220 242 3.29e-1 SMART
ZnF_C2H2 298 318 1.93e2 SMART
low complexity region 341 354 N/A INTRINSIC
ZnF_C2H2 485 507 5.9e-3 SMART
ZnF_C2H2 513 535 1.82e-3 SMART
low complexity region 576 595 N/A INTRINSIC
ZnF_C2H2 640 662 9.58e-3 SMART
ZnF_C2H2 668 690 7.37e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123562
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Other mutations in Zfp770
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfp770 APN 2 114195932 missense probably benign 0.20
IGL00478:Zfp770 APN 2 114197465 missense probably damaging 1.00
IGL01539:Zfp770 APN 2 114197093 missense probably damaging 0.99
IGL01778:Zfp770 APN 2 114196238 missense probably damaging 0.96
IGL02596:Zfp770 APN 2 114195827 missense probably benign 0.11
IGL03227:Zfp770 APN 2 114197089 nonsense probably null
R0057:Zfp770 UTSW 2 114197232 nonsense probably null
R0057:Zfp770 UTSW 2 114197232 nonsense probably null
R1081:Zfp770 UTSW 2 114197127 missense probably damaging 1.00
R1446:Zfp770 UTSW 2 114197033 missense probably damaging 0.99
R4477:Zfp770 UTSW 2 114196884 missense probably damaging 1.00
R4597:Zfp770 UTSW 2 114196770 missense possibly damaging 0.46
R4964:Zfp770 UTSW 2 114197387 missense probably benign 0.24
R4966:Zfp770 UTSW 2 114197387 missense probably benign 0.24
R5440:Zfp770 UTSW 2 114196115 missense probably benign 0.42
R5910:Zfp770 UTSW 2 114196232 nonsense probably null
R5941:Zfp770 UTSW 2 114197546 missense possibly damaging 0.83
R6074:Zfp770 UTSW 2 114196389 missense possibly damaging 0.68
R6341:Zfp770 UTSW 2 114196759 missense probably benign 0.14
R7181:Zfp770 UTSW 2 114197391 missense probably damaging 1.00
R7288:Zfp770 UTSW 2 114195661 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGGAAAGATTTACTGCACAGG -3'
(R):5'- ACAACTCGTTCATCTGGAGAGG -3'

Sequencing Primer
(F):5'- GGACACATTTAAAAGGCCTCTG -3'
(R):5'- CATCTGGAGAGGCATCAGTTAACTC -3'
Posted On2016-07-06