Incidental Mutation 'R5259:Rab33b'
ID401286
Institutional Source Beutler Lab
Gene Symbol Rab33b
Ensembl Gene ENSMUSG00000027739
Gene NameRAB33B, member RAS oncogene family
Synonyms
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5259 (G1)
Quality Score121
Status Validated
Chromosome3
Chromosomal Location51483920-51496232 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 51484612 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054387] [ENSMUST00000192172]
Predicted Effect probably benign
Transcript: ENSMUST00000054387
SMART Domains Protein: ENSMUSP00000063054
Gene: ENSMUSG00000027739

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
RAB 34 202 1.94e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192172
SMART Domains Protein: ENSMUSP00000142215
Gene: ENSMUSG00000027739

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
Pfam:Ras 35 65 7.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195715
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small GTP-binding protein of the Rab GTPase family, whose members function in vesicle transport during protein secretion and endocytosis. Rab GTPases are active, membrane-associated proteins that recruit effector proteins in the GTP-bound state and inactive cytosolic proteins when in a GDP-bound state. The protein encoded by this gene is ubiquitously expressed and has been implicated in Golgi to endoplasmic reticulum cycling of Golgi enzymes. In addition, this protein regulates Golgi homeostasis and coordinates intra-Golgi retrograde trafficking. Allelic variants in this gene have been associated with Dyggve-Melchior-Clausen syndrome and Smith-McCort dysplasia 2, which are autosomal recessive spondyloepimetaphyseal dysplasias characterized by skeletal abnormalities. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Rab33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02756:Rab33b APN 3 51484524 missense probably damaging 1.00
R0012:Rab33b UTSW 3 51484316 start gained probably benign
R0690:Rab33b UTSW 3 51493417 missense probably damaging 1.00
R1027:Rab33b UTSW 3 51484455 missense probably damaging 1.00
R3151:Rab33b UTSW 3 51493648 missense possibly damaging 0.83
R5387:Rab33b UTSW 3 51493455 missense probably damaging 1.00
R5650:Rab33b UTSW 3 51493416 missense probably damaging 1.00
R5997:Rab33b UTSW 3 51484479 missense possibly damaging 0.80
R6318:Rab33b UTSW 3 51493405 missense probably damaging 0.99
R6640:Rab33b UTSW 3 51484479 missense possibly damaging 0.80
Z1177:Rab33b UTSW 3 51484334 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- ATCATAGTGATCGGCGACTCG -3'
(R):5'- ACAGACTCATTGCATGTGCG -3'

Sequencing Primer
(F):5'- TGATCGGCGACTCGAACGTG -3'
(R):5'- GCGTTATAGGGGAGCTTATCAAATC -3'
Posted On2016-07-06