Incidental Mutation 'R5259:Kcnc4'
ID401287
Institutional Source Beutler Lab
Gene Symbol Kcnc4
Ensembl Gene ENSMUSG00000027895
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 4
SynonymsKcr2-4, Kv3.4
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5259 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107438303-107459552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107448085 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 349 (F349S)
Ref Sequence ENSEMBL: ENSMUSP00000009617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009617]
Predicted Effect probably damaging
Transcript: ENSMUST00000009617
AA Change: F349S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009617
Gene: ENSMUSG00000027895
AA Change: F349S

DomainStartEndE-ValueType
Pfam:Potassium_chann 1 29 3e-23 PFAM
BTB 36 155 4.66e-16 SMART
low complexity region 168 185 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
Pfam:Ion_trans 229 487 2.6e-46 PFAM
Pfam:Ion_trans_2 386 480 3e-12 PFAM
low complexity region 489 505 N/A INTRINSIC
Meta Mutation Damage Score 0.9384 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. It generates atypical voltage-dependent transient current that may be important for neuronal excitability. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Kcnc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnc4 APN 3 107447873 missense probably benign 0.01
IGL00899:Kcnc4 APN 3 107458463 missense possibly damaging 0.94
IGL01755:Kcnc4 APN 3 107448175 missense probably damaging 1.00
IGL01895:Kcnc4 APN 3 107448218 missense probably benign 0.01
IGL02741:Kcnc4 APN 3 107447978 missense probably damaging 0.98
IGL03393:Kcnc4 APN 3 107447927 missense possibly damaging 0.75
PIT4151001:Kcnc4 UTSW 3 107458703 missense probably damaging 1.00
PIT4378001:Kcnc4 UTSW 3 107447563 missense probably benign
R0158:Kcnc4 UTSW 3 107458604 missense probably benign 0.21
R0415:Kcnc4 UTSW 3 107445433 missense probably damaging 1.00
R0704:Kcnc4 UTSW 3 107447963 missense possibly damaging 0.92
R0747:Kcnc4 UTSW 3 107448154 missense probably damaging 1.00
R1481:Kcnc4 UTSW 3 107448218 missense probably benign 0.02
R1540:Kcnc4 UTSW 3 107445427 splice site probably null
R1602:Kcnc4 UTSW 3 107448204 missense possibly damaging 0.96
R2422:Kcnc4 UTSW 3 107445547 missense probably benign 0.30
R3750:Kcnc4 UTSW 3 107448190 missense probably benign 0.36
R4791:Kcnc4 UTSW 3 107447543 missense probably benign 0.32
R4815:Kcnc4 UTSW 3 107458266 missense probably benign 0.37
R5216:Kcnc4 UTSW 3 107439441 missense probably benign
R5317:Kcnc4 UTSW 3 107458739 missense probably damaging 0.98
R5474:Kcnc4 UTSW 3 107447891 missense possibly damaging 0.82
R5783:Kcnc4 UTSW 3 107447872 missense possibly damaging 0.69
R5865:Kcnc4 UTSW 3 107458199 critical splice donor site probably null
R6228:Kcnc4 UTSW 3 107448377 missense probably damaging 0.99
R6536:Kcnc4 UTSW 3 107448196 missense possibly damaging 0.81
R7018:Kcnc4 UTSW 3 107458862 missense probably benign 0.00
R7319:Kcnc4 UTSW 3 107458784 missense probably benign 0.21
R7687:Kcnc4 UTSW 3 107458609 small insertion probably benign
R8436:Kcnc4 UTSW 3 107458768 missense probably damaging 0.96
R8707:Kcnc4 UTSW 3 107448133 missense possibly damaging 0.76
R8844:Kcnc4 UTSW 3 107448080 missense probably damaging 1.00
R8868:Kcnc4 UTSW 3 107448136 missense probably damaging 1.00
X0020:Kcnc4 UTSW 3 107447651 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCGGCATAATAGATCATGGTGG -3'
(R):5'- AGGGAATATCACCAGCGTGC -3'

Sequencing Primer
(F):5'- TGGCGAAGATGAGCACACCC -3'
(R):5'- ATTCTTACCTACATCGAGGGTG -3'
Posted On2016-07-06