Incidental Mutation 'R5259:Olfr857'
ID401307
Institutional Source Beutler Lab
Gene Symbol Olfr857
Ensembl Gene ENSMUSG00000094678
Gene Nameolfactory receptor 857
SynonymsMOR146-8P, GA_x6K02T2PVTD-13452606-13453535
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5259 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19709433-19714930 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 19712813 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077023] [ENSMUST00000212013] [ENSMUST00000212013] [ENSMUST00000217450]
Predicted Effect probably null
Transcript: ENSMUST00000077023
SMART Domains Protein: ENSMUSP00000076281
Gene: ENSMUSG00000094678

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.5e-5 PFAM
Pfam:7tm_1 41 290 9.4e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212013
Predicted Effect probably null
Transcript: ENSMUST00000212013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212753
Predicted Effect probably null
Transcript: ENSMUST00000217450
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Olfr857
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Olfr857 APN 9 19713279 missense probably benign 0.00
IGL01919:Olfr857 APN 9 19713342 missense probably benign 0.00
IGL02157:Olfr857 APN 9 19713289 missense probably benign 0.07
IGL02550:Olfr857 APN 9 19713047 missense possibly damaging 0.92
IGL03329:Olfr857 APN 9 19713301 missense probably benign 0.16
IGL02799:Olfr857 UTSW 9 19713018 missense probably damaging 0.99
R0356:Olfr857 UTSW 9 19713447 missense probably damaging 1.00
R0927:Olfr857 UTSW 9 19713649 missense probably benign 0.39
R1161:Olfr857 UTSW 9 19713180 missense probably damaging 1.00
R1848:Olfr857 UTSW 9 19713090 missense probably benign 0.01
R5191:Olfr857 UTSW 9 19713334 missense probably damaging 0.98
R5216:Olfr857 UTSW 9 19713289 missense probably benign 0.07
R5342:Olfr857 UTSW 9 19713037 missense probably damaging 1.00
R5506:Olfr857 UTSW 9 19713274 missense possibly damaging 0.61
R5526:Olfr857 UTSW 9 19713698 nonsense probably null
R5594:Olfr857 UTSW 9 19713006 missense probably damaging 0.99
R5928:Olfr857 UTSW 9 19713753 missense probably benign 0.02
R6569:Olfr857 UTSW 9 19713342 missense probably benign 0.00
R6858:Olfr857 UTSW 9 19713469 missense probably damaging 0.98
R7077:Olfr857 UTSW 9 19713132 missense probably benign
R7378:Olfr857 UTSW 9 19712887 missense probably damaging 1.00
R7771:Olfr857 UTSW 9 19713471 missense probably benign
R8038:Olfr857 UTSW 9 19713680 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AAGCTCCTAACCCTAGAACCTTTTC -3'
(R):5'- AGCCCATGTCAGACAATGAAAG -3'

Sequencing Primer
(F):5'- AACCCTAGAACCTTTTCCTGAG -3'
(R):5'- CCATGTCAGACAATGAAAGGTTGTAG -3'
Posted On2016-07-06