Incidental Mutation 'R5259:Fam13c'
ID401310
Institutional Source Beutler Lab
Gene Symbol Fam13c
Ensembl Gene ENSMUSG00000043259
Gene Namefamily with sequence similarity 13, member C
Synonyms
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5259 (G1)
Quality Score212
Status Validated
Chromosome10
Chromosomal Location70440481-70558736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 70441063 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 17 (A17G)
Ref Sequence ENSEMBL: ENSMUSP00000051375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062883] [ENSMUST00000105436] [ENSMUST00000173042]
Predicted Effect probably benign
Transcript: ENSMUST00000062883
AA Change: A17G

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051375
Gene: ENSMUSG00000043259
AA Change: A17G

DomainStartEndE-ValueType
low complexity region 200 222 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
coiled coil region 304 372 N/A INTRINSIC
coiled coil region 529 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105436
SMART Domains Protein: ENSMUSP00000101076
Gene: ENSMUSG00000043259

DomainStartEndE-ValueType
low complexity region 118 140 N/A INTRINSIC
low complexity region 192 212 N/A INTRINSIC
coiled coil region 222 290 N/A INTRINSIC
coiled coil region 447 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173042
AA Change: A17G

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134648
Gene: ENSMUSG00000043259
AA Change: A17G

DomainStartEndE-ValueType
low complexity region 200 222 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
coiled coil region 304 372 N/A INTRINSIC
coiled coil region 528 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220442
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Fam13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Fam13c APN 10 70448816 critical splice donor site probably null
IGL02060:Fam13c APN 10 70553141 missense probably damaging 1.00
IGL03218:Fam13c APN 10 70448769 missense possibly damaging 0.46
R0270:Fam13c UTSW 10 70544513 missense probably benign 0.05
R0418:Fam13c UTSW 10 70534761 missense probably damaging 1.00
R0617:Fam13c UTSW 10 70536352 splice site probably benign
R1712:Fam13c UTSW 10 70554573 missense possibly damaging 0.80
R1967:Fam13c UTSW 10 70551735 missense probably damaging 1.00
R2165:Fam13c UTSW 10 70542693 missense probably damaging 1.00
R3836:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R3837:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R3838:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R3839:Fam13c UTSW 10 70542648 missense probably damaging 1.00
R4059:Fam13c UTSW 10 70554508 missense probably damaging 1.00
R4768:Fam13c UTSW 10 70551750 missense probably damaging 0.96
R4951:Fam13c UTSW 10 70551791 critical splice donor site probably null
R5384:Fam13c UTSW 10 70553069 missense probably benign 0.03
R5715:Fam13c UTSW 10 70534840 missense probably damaging 1.00
R6322:Fam13c UTSW 10 70498891 missense probably damaging 0.99
R6404:Fam13c UTSW 10 70448816 critical splice donor site probably null
R6723:Fam13c UTSW 10 70554525 missense probably damaging 1.00
R7111:Fam13c UTSW 10 70554506 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCAGGAGCATGTGCAGACAG -3'
(R):5'- ATATTTTGGGCCACGGAGCC -3'

Sequencing Primer
(F):5'- CAGCAGCCCAAGGTAGAGC -3'
(R):5'- AATACTGGCTGCAACCTGTG -3'
Posted On2016-07-06