Incidental Mutation 'R5259:Adi1'
ID401315
Institutional Source Beutler Lab
Gene Symbol Adi1
Ensembl Gene ENSMUSG00000020629
Gene Nameacireductone dioxygenase 1
Synonyms
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R5259 (G1)
Quality Score171
Status Validated
Chromosome12
Chromosomal Location28675231-28682175 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 28675545 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020957]
PDB Structure
Crystal structure of Acireductone dioxygenase (13543033) from Mus musculus at 2.06 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020957
SMART Domains Protein: ENSMUSP00000020957
Gene: ENSMUSG00000020629

DomainStartEndE-ValueType
Pfam:ARD 3 157 6.7e-64 PFAM
Pfam:AraC_binding 78 156 1.3e-8 PFAM
Pfam:Cupin_2 81 151 2.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135772
SMART Domains Protein: ENSMUSP00000122965
Gene: ENSMUSG00000020629

DomainStartEndE-ValueType
Pfam:ARD 18 139 3.2e-55 PFAM
Pfam:AraC_binding 59 138 1.9e-8 PFAM
Pfam:Cupin_2 63 133 3.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184974
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the aci-reductone dioxygenase family of metal-binding enzymes, which are involved in methionine salvage. This enzyme may regulate mRNA processing in the nucleus, and may carry out different functions depending on its localization. Related pseudogenes have been defined on chromosomes 8 and 20. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Adi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Adi1 APN 12 28679467 missense probably damaging 1.00
R1836:Adi1 UTSW 12 28679563 missense probably benign 0.34
R4832:Adi1 UTSW 12 28675253 start codon destroyed probably null 0.05
R5393:Adi1 UTSW 12 28675275 missense probably benign 0.37
R5833:Adi1 UTSW 12 28681042 missense probably benign 0.01
R6029:Adi1 UTSW 12 28679319 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCTATTGGAAGGTACGAGTGCAG -3'
(R):5'- ATCAAACGTTCCTCAGGCATG -3'

Sequencing Primer
(F):5'- TACGAGTGCAGGCCGGAG -3'
(R):5'- CAAGGCCAGTTGGTTTGCAC -3'
Posted On2016-07-06