Incidental Mutation 'R5259:Larp4b'
ID401317
Institutional Source Beutler Lab
Gene Symbol Larp4b
Ensembl Gene ENSMUSG00000033499
Gene NameLa ribonucleoprotein domain family, member 4B
SynonymsLarp5, D13Wsu64e
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R5259 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location9093881-9174451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9158184 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 398 (A398V)
Ref Sequence ENSEMBL: ENSMUSP00000139578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091829] [ENSMUST00000188211] [ENSMUST00000188939]
Predicted Effect probably damaging
Transcript: ENSMUST00000091829
AA Change: A398V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089437
Gene: ENSMUSG00000033499
AA Change: A398V

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188211
AA Change: A398V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140993
Gene: ENSMUSG00000033499
AA Change: A398V

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188939
AA Change: A398V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139578
Gene: ENSMUSG00000033499
AA Change: A398V

DomainStartEndE-ValueType
LA 156 234 3.25e-36 SMART
RRM 239 309 6.25e-2 SMART
low complexity region 510 529 N/A INTRINSIC
Meta Mutation Damage Score 0.1416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an evolutionarily conserved protein family implicated in RNA metabolism and translation. Members of this family are characterized by the presence of an La motif, which is often located adjacent to one or more RNA recognition motifs (RRM). Together, the two motifs constitute the functional region of the protein and enable its interaction with the RNA substrate. This protein family is divided into five sub-families: the genuine La proteins and four La-related protein (LARP) sub-families. The protein encoded by this gene belongs to LARP sub-family 4. It is a cytoplasmic protein that may play a stimulatory role in translation. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Larp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Larp4b APN 13 9158124 missense probably damaging 0.99
IGL02519:Larp4b APN 13 9158580 missense probably benign 0.04
IGL02609:Larp4b APN 13 9170680 missense probably damaging 1.00
R0116:Larp4b UTSW 13 9170688 missense probably damaging 1.00
R0390:Larp4b UTSW 13 9158107 intron probably null
R0585:Larp4b UTSW 13 9147493 missense probably damaging 1.00
R0585:Larp4b UTSW 13 9170701 missense probably benign 0.08
R0751:Larp4b UTSW 13 9166309 splice site probably benign
R1184:Larp4b UTSW 13 9166309 splice site probably benign
R1202:Larp4b UTSW 13 9166326 missense possibly damaging 0.84
R1525:Larp4b UTSW 13 9145450 missense probably damaging 1.00
R1599:Larp4b UTSW 13 9122150 missense probably damaging 1.00
R1637:Larp4b UTSW 13 9151097 missense probably benign 0.12
R1833:Larp4b UTSW 13 9151199 missense possibly damaging 0.89
R1852:Larp4b UTSW 13 9137303 critical splice donor site probably null
R1962:Larp4b UTSW 13 9136842 missense probably benign
R2359:Larp4b UTSW 13 9158163 missense probably damaging 0.97
R2973:Larp4b UTSW 13 9166311 splice site probably benign
R3803:Larp4b UTSW 13 9158554 missense probably benign 0.03
R4810:Larp4b UTSW 13 9158591 missense probably benign
R4828:Larp4b UTSW 13 9170898 missense probably damaging 1.00
R5135:Larp4b UTSW 13 9170737 missense probably damaging 1.00
R5250:Larp4b UTSW 13 9170977 utr 3 prime probably benign
R5379:Larp4b UTSW 13 9136909 missense probably benign 0.17
R5436:Larp4b UTSW 13 9168900 missense possibly damaging 0.93
R5616:Larp4b UTSW 13 9158659 missense probably damaging 0.98
R5774:Larp4b UTSW 13 9170643 splice site probably null
R5818:Larp4b UTSW 13 9158560 missense probably benign
R6007:Larp4b UTSW 13 9168757 missense probably benign 0.13
R6248:Larp4b UTSW 13 9158702 missense probably benign 0.01
R6452:Larp4b UTSW 13 9147467 missense probably damaging 0.98
R6501:Larp4b UTSW 13 9168793 missense probably damaging 1.00
R7324:Larp4b UTSW 13 9158580 missense probably benign 0.04
R7689:Larp4b UTSW 13 9136798 missense probably damaging 1.00
R7737:Larp4b UTSW 13 9170643 splice site probably null
RF017:Larp4b UTSW 13 9123910 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCTCGATAGACATTACCTGTAG -3'
(R):5'- TCACTGCTGGCATCCATTGG -3'

Sequencing Primer
(F):5'- ACACTGCAGCCATTTTTAAGC -3'
(R):5'- CCATTGGGGGCTTCCTTTAGATTAC -3'
Posted On2016-07-06