Incidental Mutation 'R5259:Scamp1'
ID401320
Institutional Source Beutler Lab
Gene Symbol Scamp1
Ensembl Gene ENSMUSG00000021687
Gene Namesecretory carrier membrane protein 1
Synonyms
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5259 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location94201310-94285857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 94232086 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 58 (N58T)
Ref Sequence ENSEMBL: ENSMUSP00000120053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022197] [ENSMUST00000138255] [ENSMUST00000152555] [ENSMUST00000153558]
Predicted Effect probably benign
Transcript: ENSMUST00000022197
AA Change: N110T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022197
Gene: ENSMUSG00000021687
AA Change: N110T

DomainStartEndE-ValueType
coiled coil region 75 114 N/A INTRINSIC
Pfam:SCAMP 117 292 7.4e-74 PFAM
low complexity region 314 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138255
AA Change: N58T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121039
Gene: ENSMUSG00000021687
AA Change: N58T

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 116 2.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152555
AA Change: N58T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123135
Gene: ENSMUSG00000021687
AA Change: N58T

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 241 2.3e-78 PFAM
low complexity region 262 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153558
AA Change: N58T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120053
Gene: ENSMUSG00000021687
AA Change: N58T

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 241 2.3e-78 PFAM
low complexity region 262 280 N/A INTRINSIC
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any overt abnormalities, but final cell capacitance of mast cells completing exocytosis was smaller than controls and an increased proportion of reversible fusion events was noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Scamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Scamp1 APN 13 94204022 missense probably damaging 1.00
IGL02269:Scamp1 APN 13 94232186 splice site probably benign
R0067:Scamp1 UTSW 13 94204150 missense probably damaging 1.00
R0067:Scamp1 UTSW 13 94204150 missense probably damaging 1.00
R0254:Scamp1 UTSW 13 94210580 missense probably benign 0.00
R0367:Scamp1 UTSW 13 94210580 missense probably benign 0.01
R0559:Scamp1 UTSW 13 94208182 missense possibly damaging 0.79
R1147:Scamp1 UTSW 13 94224886 unclassified probably null
R1400:Scamp1 UTSW 13 94224947 missense possibly damaging 0.53
R1499:Scamp1 UTSW 13 94224929 missense probably benign 0.03
R5206:Scamp1 UTSW 13 94232107 missense probably damaging 1.00
R5300:Scamp1 UTSW 13 94204162 missense probably damaging 0.99
R6128:Scamp1 UTSW 13 94208227 missense possibly damaging 0.80
R7017:Scamp1 UTSW 13 94224915 missense probably damaging 0.98
R7219:Scamp1 UTSW 13 94224907 missense probably damaging 1.00
R7242:Scamp1 UTSW 13 94233140 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGATCTGTCTCACTTTCTCGGAG -3'
(R):5'- CGTGGTATAAAGGTAGGCACGC -3'

Sequencing Primer
(F):5'- CTATCAAAAGACTGTAGCTATCAGGC -3'
(R):5'- AGGCACGCAGATGTTGGAATATTTC -3'
Posted On2016-07-06