Incidental Mutation 'R5259:Atp13a4'
ID401327
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene NameATPase type 13A4
Synonyms9330174J19Rik, 4631413J11Rik
MMRRC Submission 042856-MU
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5259 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location29395853-29544864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29456610 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 352 (T352M)
Ref Sequence ENSEMBL: ENSMUSP00000138479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
Predicted Effect probably damaging
Transcript: ENSMUST00000039090
AA Change: T352M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094
AA Change: T352M

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000057018
AA Change: T352M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: T352M

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182573
Predicted Effect probably damaging
Transcript: ENSMUST00000182627
AA Change: T352M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: T352M

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Fra10ac1 A G 19: 38,199,662 S229P probably benign Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7950:Atp13a4 UTSW 16 29449917 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
R8488:Atp13a4 UTSW 16 29417836 missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29454769 nonsense probably null
R8773:Atp13a4 UTSW 16 29441580 missense
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- TTACTGAGATGCACAGGCCAC -3'
(R):5'- GATTTGCACAGGAAAGGCAC -3'

Sequencing Primer
(F):5'- CACAGACTTACATGTATTTGTGGTGC -3'
(R):5'- CTCCACCCCACAAAGTAAGATTG -3'
Posted On2016-07-06