Incidental Mutation 'R5259:Fra10ac1'
ID401338
Institutional Source Beutler Lab
Gene Symbol Fra10ac1
Ensembl Gene ENSMUSG00000054237
Gene NameFRA10AC1 homolog (human)
Synonyms5730455O13Rik
MMRRC Submission 042856-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R5259 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location38188481-38224138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38199662 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 229 (S229P)
Ref Sequence ENSEMBL: ENSMUSP00000070534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067167]
Predicted Effect probably benign
Transcript: ENSMUST00000067167
AA Change: S229P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070534
Gene: ENSMUSG00000054237
AA Change: S229P

DomainStartEndE-ValueType
Pfam:Fra10Ac1 104 220 7e-56 PFAM
low complexity region 228 237 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 278 288 N/A INTRINSIC
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear phosphoprotein of unknown function. This gene contains a tandem CGG repeat region within a CpG island that normally consists of 8-14 repeats but can expand to over 200 repeats. The repeat region is within the 5' UTR of some transcript variants, but is intronic to another variant. The expanded repeat allele is a fragile site and becomes hypermethylated, causing a reduction in gene expression. A disease phenotype has not been associated with expanded alleles. This gene is found within the rare FRA10A folate-sensitive fragile site. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T C 8: 45,962,336 E211G probably benign Het
2310035C23Rik A G 1: 105,721,376 S747G probably benign Het
Abhd18 A C 3: 40,916,890 T50P probably damaging Het
Adam5 T A 8: 24,810,834 L226F possibly damaging Het
Adi1 T C 12: 28,675,545 probably benign Het
Apc T C 18: 34,314,290 V1379A probably benign Het
Atp13a4 G A 16: 29,456,610 T352M probably damaging Het
Baat T A 4: 49,490,070 N338I probably benign Het
Bdnf A G 2: 109,723,982 T234A probably benign Het
Catsperd A C 17: 56,660,235 T539P possibly damaging Het
Cd109 A T 9: 78,710,152 T1311S probably benign Het
Ceacam18 T C 7: 43,637,112 probably null Het
Chsy3 T A 18: 59,410,246 S819T probably damaging Het
Col4a4 G T 1: 82,453,893 R1557S unknown Het
Ddx18 A G 1: 121,567,789 probably null Het
Depdc5 C T 5: 32,938,291 P824L probably damaging Het
Fam13c C G 10: 70,441,063 A17G probably benign Het
Fermt1 T C 2: 132,906,765 Y646C probably damaging Het
Gbp8 A T 5: 105,050,979 H23Q probably benign Het
Gdf2 T C 14: 33,944,831 V170A probably benign Het
Gm15723 T C 10: 114,816,817 noncoding transcript Het
Gm4788 C T 1: 139,740,495 C300Y probably damaging Het
Gm5415 A T 1: 32,545,517 C437* probably null Het
Gm815 G A 19: 26,886,406 V16I unknown Het
Ighv1-75 T A 12: 115,834,177 K42* probably null Het
Isx A G 8: 74,892,845 T222A probably benign Het
Itgax G A 7: 128,148,278 D1018N probably damaging Het
Kcnc4 A G 3: 107,448,085 F349S probably damaging Het
Lama3 A C 18: 12,465,508 S991R probably damaging Het
Larp4b C T 13: 9,158,184 A398V probably damaging Het
Ltbp1 A G 17: 75,363,362 N1466S probably benign Het
Metrn A T 17: 25,796,540 L67Q probably damaging Het
Morc1 G A 16: 48,630,769 R937Q probably benign Het
Mta3 A G 17: 83,804,574 Y577C probably damaging Het
Nalcn A G 14: 123,515,651 F308L possibly damaging Het
Nat8 A T 6: 85,830,891 S87T probably benign Het
Olfr319 A G 11: 58,701,952 N84D probably benign Het
Olfr319 A C 11: 58,701,953 N84T possibly damaging Het
Olfr857 A G 9: 19,712,813 probably null Het
Oplah A T 15: 76,301,210 probably null Het
Pcdh15 A T 10: 74,396,372 I668L possibly damaging Het
Pecr A G 1: 72,277,285 probably null Het
Plxna4 T C 6: 32,517,021 E220G possibly damaging Het
Pnmal2 A G 7: 16,945,274 K61R unknown Het
Prl8a6 C T 13: 27,436,196 W81* probably null Het
Rab33b C T 3: 51,484,612 probably benign Het
Rbm33 T A 5: 28,352,774 probably null Het
Reln C T 5: 22,103,397 V325M possibly damaging Het
Rheb A C 5: 24,803,745 D158E probably benign Het
Rhebl1 T A 15: 98,880,583 probably benign Het
Rmdn2 T A 17: 79,668,017 Y312N probably damaging Het
Scamp1 T G 13: 94,232,086 N58T probably benign Het
Slc35a1 C T 4: 34,683,322 V53M probably benign Het
Slc35f3 A T 8: 126,389,133 L266F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Ticrr T A 7: 79,694,723 S1445R probably benign Het
Ttc23l T C 15: 10,515,150 N381D probably damaging Het
Usp17ld T A 7: 103,250,574 K384* probably null Het
Vmn1r20 T A 6: 57,432,065 Y125* probably null Het
Zfp738 G T 13: 67,669,686 Q729K probably benign Het
Zfp770 T A 2: 114,197,193 M132L probably benign Het
Other mutations in Fra10ac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Fra10ac1 APN 19 38201564 missense probably damaging 0.99
IGL01784:Fra10ac1 APN 19 38219677 missense probably benign 0.32
IGL03396:Fra10ac1 APN 19 38201546 critical splice donor site probably null
R4349:Fra10ac1 UTSW 19 38199605 missense probably benign 0.00
R5090:Fra10ac1 UTSW 19 38214425 missense probably damaging 1.00
R5234:Fra10ac1 UTSW 19 38215846 missense probably damaging 1.00
R5445:Fra10ac1 UTSW 19 38219462 missense possibly damaging 0.82
R5768:Fra10ac1 UTSW 19 38207286 missense probably benign 0.02
R6756:Fra10ac1 UTSW 19 38215865 missense probably damaging 1.00
R6831:Fra10ac1 UTSW 19 38207289 missense probably benign 0.38
R7011:Fra10ac1 UTSW 19 38188794 missense probably benign 0.11
R7054:Fra10ac1 UTSW 19 38224119 start gained probably benign
R7530:Fra10ac1 UTSW 19 38215905 nonsense probably null
R7561:Fra10ac1 UTSW 19 38221876 missense probably damaging 1.00
R7715:Fra10ac1 UTSW 19 38189838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGATTCTGACCAGTGCCG -3'
(R):5'- TCACTGGATATGAGTTACGTGC -3'

Sequencing Primer
(F):5'- GTGGCCGTCTGTATCTCACAC -3'
(R):5'- TGCATACTCTAGCATGGCAG -3'
Posted On2016-07-06