Incidental Mutation 'R5260:Ptpn18'
ID 401339
Institutional Source Beutler Lab
Gene Symbol Ptpn18
Ensembl Gene ENSMUSG00000026126
Gene Name protein tyrosine phosphatase, non-receptor type 18
Synonyms Ptpk1, PTP-HSCF, FLP1, HSCF, PTP-K1
MMRRC Submission 042829-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.156) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 34498843-34514814 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 34502591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000190122]
AlphaFold Q61152
Predicted Effect probably benign
Transcript: ENSMUST00000027302
SMART Domains Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126

DomainStartEndE-ValueType
PTPc 25 293 7.77e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188884
Predicted Effect probably benign
Transcript: ENSMUST00000190122
SMART Domains Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126

DomainStartEndE-ValueType
PTPc 2 269 9.1e-113 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A T 7: 132,461,003 (GRCm39) I14F probably damaging Het
Acin1 T C 14: 54,880,279 (GRCm39) probably benign Het
Adamts9 C A 6: 92,784,118 (GRCm39) V1579L probably benign Het
Adra2a T A 19: 54,035,039 (GRCm39) C132S probably damaging Het
Aif1 T A 17: 35,390,917 (GRCm39) probably null Het
Atf5 A T 7: 44,464,510 (GRCm39) Y27* probably null Het
Atm A G 9: 53,417,911 (GRCm39) S799P probably damaging Het
Bmp2k T G 5: 97,235,210 (GRCm39) probably benign Het
Chaf1a C T 17: 56,372,000 (GRCm39) H723Y probably damaging Het
Clint1 T C 11: 45,798,769 (GRCm39) W493R probably damaging Het
Cyb561a3 T A 19: 10,565,230 (GRCm39) V198D possibly damaging Het
Cyp2j8 T C 4: 96,389,301 (GRCm39) E174G possibly damaging Het
Cyp4v3 C T 8: 45,760,017 (GRCm39) G512S probably damaging Het
Dnah8 T A 17: 30,919,393 (GRCm39) V1122D probably benign Het
Doc2b C A 11: 75,676,989 (GRCm39) G128V probably damaging Het
Dysf T C 6: 84,127,016 (GRCm39) V1378A probably damaging Het
Efcab5 A T 11: 77,028,477 (GRCm39) S421T possibly damaging Het
Efcab6 T G 15: 83,829,324 (GRCm39) D672A probably benign Het
Eif2ak3 C A 6: 70,870,113 (GRCm39) H933Q probably damaging Het
Erc1 A T 6: 119,738,120 (GRCm39) N574K probably damaging Het
Eri2 A T 7: 119,387,069 (GRCm39) probably benign Het
Faxc A G 4: 21,948,744 (GRCm39) Y152C probably damaging Het
Fbxl7 T A 15: 26,543,585 (GRCm39) Y354F probably damaging Het
Fras1 T A 5: 96,883,046 (GRCm39) I2526N possibly damaging Het
Gm5424 A T 10: 61,907,374 (GRCm39) noncoding transcript Het
Gm6728 T C 6: 136,463,701 (GRCm39) noncoding transcript Het
Golgb1 A T 16: 36,733,503 (GRCm39) S917C probably benign Het
Gtpbp3 T C 8: 71,942,062 (GRCm39) probably benign Het
Gusb A T 5: 130,028,829 (GRCm39) Y220* probably null Het
Gvin3 A G 7: 106,198,411 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,471,612 (GRCm39) V4914A possibly damaging Het
Iars2 C A 1: 185,055,931 (GRCm39) C211F probably damaging Het
Kif5b A G 18: 6,211,058 (GRCm39) L802P probably damaging Het
Kif5c A G 2: 49,625,602 (GRCm39) E624G probably damaging Het
Kmt2d G T 15: 98,740,741 (GRCm39) probably benign Het
Krt82 C A 15: 101,456,823 (GRCm39) G186C possibly damaging Het
Lca5 G A 9: 83,305,276 (GRCm39) R177C probably damaging Het
Mab21l4 A T 1: 93,087,700 (GRCm39) V51E probably damaging Het
Mier1 T C 4: 103,019,907 (GRCm39) S318P probably benign Het
Obscn A T 11: 58,894,195 (GRCm39) I1207N probably damaging Het
Oog4 C T 4: 143,164,424 (GRCm39) G369D probably benign Het
Or4c126 A G 2: 89,824,526 (GRCm39) D263G probably damaging Het
Or4k52 A G 2: 111,611,526 (GRCm39) Y287C probably damaging Het
Or52d13 A G 7: 103,109,822 (GRCm39) F198L probably benign Het
Or5d35 A C 2: 87,855,818 (GRCm39) I251L probably benign Het
Plec T C 15: 76,060,824 (GRCm39) T3060A probably damaging Het
Plekhh2 C T 17: 84,884,593 (GRCm39) T769I probably damaging Het
Prkaa1 A T 15: 5,190,149 (GRCm39) S65C probably damaging Het
Psma3 T C 12: 71,031,416 (GRCm39) probably benign Het
Ptprv T C 1: 135,039,998 (GRCm39) noncoding transcript Het
Rac1 C A 5: 143,493,886 (GRCm39) V104L probably benign Het
Serpinb7 A T 1: 107,362,479 (GRCm39) N61I possibly damaging Het
Sirt7 A C 11: 120,511,347 (GRCm39) probably benign Het
Srl G A 16: 4,300,759 (GRCm39) R333* probably null Het
Srprb A T 9: 103,079,119 (GRCm39) L756Q probably damaging Het
Tchhl1 T C 3: 93,378,102 (GRCm39) S269P probably damaging Het
Tdo2 C T 3: 81,882,630 (GRCm39) probably null Het
Teddm1a T C 1: 153,767,646 (GRCm39) Y37H probably benign Het
Tenm3 T C 8: 48,689,890 (GRCm39) Y1899C probably damaging Het
Tep1 T C 14: 51,076,088 (GRCm39) T1681A probably benign Het
Timm44 G T 8: 4,325,919 (GRCm39) probably null Het
Trp73 A G 4: 154,147,059 (GRCm39) V322A possibly damaging Het
Tsr1 A C 11: 74,796,781 (GRCm39) E611A probably damaging Het
Unc80 A G 1: 66,685,746 (GRCm39) N2290S possibly damaging Het
Ush2a T C 1: 188,679,276 (GRCm39) V4828A possibly damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnt9b C A 11: 103,622,875 (GRCm39) S176I possibly damaging Het
Zfp329 A G 7: 12,540,453 (GRCm39) probably benign Het
Zfp352 T A 4: 90,112,697 (GRCm39) V279D probably damaging Het
Zfp932 C T 5: 110,157,501 (GRCm39) Q400* probably null Het
Zxdc T A 6: 90,359,075 (GRCm39) L569Q probably damaging Het
Other mutations in Ptpn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ptpn18 APN 1 34,502,200 (GRCm39) missense probably damaging 0.98
IGL01611:Ptpn18 APN 1 34,498,898 (GRCm39) utr 5 prime probably benign
IGL01633:Ptpn18 APN 1 34,510,989 (GRCm39) missense probably benign 0.03
IGL03379:Ptpn18 APN 1 34,509,338 (GRCm39) splice site probably null
R0848:Ptpn18 UTSW 1 34,501,783 (GRCm39) missense probably damaging 1.00
R1400:Ptpn18 UTSW 1 34,502,587 (GRCm39) critical splice donor site probably null
R1973:Ptpn18 UTSW 1 34,502,190 (GRCm39) missense probably damaging 1.00
R2040:Ptpn18 UTSW 1 34,509,300 (GRCm39) missense probably damaging 0.99
R2113:Ptpn18 UTSW 1 34,510,742 (GRCm39) missense probably damaging 1.00
R2963:Ptpn18 UTSW 1 34,510,773 (GRCm39) nonsense probably null
R4061:Ptpn18 UTSW 1 34,512,011 (GRCm39) missense possibly damaging 0.66
R4062:Ptpn18 UTSW 1 34,512,011 (GRCm39) missense possibly damaging 0.66
R4509:Ptpn18 UTSW 1 34,501,823 (GRCm39) missense possibly damaging 0.49
R4522:Ptpn18 UTSW 1 34,512,041 (GRCm39) missense probably benign
R4626:Ptpn18 UTSW 1 34,510,873 (GRCm39) splice site probably null
R4978:Ptpn18 UTSW 1 34,508,894 (GRCm39) intron probably benign
R5335:Ptpn18 UTSW 1 34,502,259 (GRCm39) missense probably damaging 1.00
R5481:Ptpn18 UTSW 1 34,510,744 (GRCm39) missense possibly damaging 0.67
R5865:Ptpn18 UTSW 1 34,510,644 (GRCm39) splice site probably benign
R7038:Ptpn18 UTSW 1 34,498,906 (GRCm39) start codon destroyed probably null 1.00
R7225:Ptpn18 UTSW 1 34,511,927 (GRCm39) missense possibly damaging 0.58
R7290:Ptpn18 UTSW 1 34,501,892 (GRCm39) critical splice donor site probably null
R7411:Ptpn18 UTSW 1 34,511,273 (GRCm39) critical splice donor site probably null
R7434:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7441:Ptpn18 UTSW 1 34,512,416 (GRCm39) missense probably benign 0.00
R7442:Ptpn18 UTSW 1 34,501,831 (GRCm39) missense probably benign 0.02
R7462:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7463:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7464:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7465:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7535:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7537:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7678:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7689:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7899:Ptpn18 UTSW 1 34,508,986 (GRCm39) splice site probably null
R8543:Ptpn18 UTSW 1 34,511,229 (GRCm39) missense probably benign 0.00
R8821:Ptpn18 UTSW 1 34,511,271 (GRCm39) missense probably null 1.00
R8831:Ptpn18 UTSW 1 34,511,271 (GRCm39) missense probably null 1.00
R8858:Ptpn18 UTSW 1 34,502,196 (GRCm39) missense possibly damaging 0.88
R8879:Ptpn18 UTSW 1 34,502,211 (GRCm39) missense probably benign 0.23
R8924:Ptpn18 UTSW 1 34,498,966 (GRCm39) missense probably benign 0.02
R9657:Ptpn18 UTSW 1 34,512,473 (GRCm39) missense possibly damaging 0.87
X0065:Ptpn18 UTSW 1 34,508,972 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGTTGGACTTCTGGC -3'
(R):5'- ACATGATGTGGGCTGATCGG -3'

Sequencing Primer
(F):5'- TGGACTTCTGGCGCCTG -3'
(R):5'- TGCCAGTACTGTGGGGACAAC -3'
Posted On 2016-07-06