Incidental Mutation 'R5260:Kif5c'
ID 401348
Institutional Source Beutler Lab
Gene Symbol Kif5c
Ensembl Gene ENSMUSG00000026764
Gene Name kinesin family member 5C
Synonyms Khc
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 49619298-49774778 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49735590 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 624 (E624G)
Ref Sequence ENSEMBL: ENSMUSP00000028102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028102]
AlphaFold P28738
PDB Structure Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-AlFx [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-VO4 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028102
AA Change: E624G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028102
Gene: ENSMUSG00000026764
AA Change: E624G

DomainStartEndE-ValueType
KISc 6 335 2.8e-173 SMART
low complexity region 340 357 N/A INTRINSIC
coiled coil region 407 541 N/A INTRINSIC
coiled coil region 592 803 N/A INTRINSIC
coiled coil region 826 915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152353
Meta Mutation Damage Score 0.0925 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin heavy chain subunit involved in the transport of cargo within the central nervous system. The encoded protein, which acts as a tetramer by associating with another heavy chain and two light chains, interacts with protein kinase CK2. Mutations in this gene have been associated with complex cortical dysplasia with other brain malformations-2. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homezygous for disruptions in this gene are viable, fertile, and of normal size. The brain is normal but slightly reduced in size with decreased numbers of motor neurons an somewhat more sensory nerves than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Kif5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Kif5c APN 2 49694816 missense possibly damaging 0.81
IGL01432:Kif5c APN 2 49701077 missense probably damaging 1.00
IGL01459:Kif5c APN 2 49735557 missense probably benign 0.36
IGL02127:Kif5c APN 2 49701110 splice site probably null
IGL03088:Kif5c APN 2 49744443 missense probably benign 0.01
IGL03379:Kif5c APN 2 49701092 missense probably damaging 0.97
IGL02988:Kif5c UTSW 2 49619717 missense probably damaging 0.97
PIT4131001:Kif5c UTSW 2 49694032 missense probably damaging 0.99
PIT4469001:Kif5c UTSW 2 49741348 missense probably benign 0.00
R0017:Kif5c UTSW 2 49732713 missense probably benign
R0017:Kif5c UTSW 2 49732713 missense probably benign
R0116:Kif5c UTSW 2 49752239 splice site probably benign
R0550:Kif5c UTSW 2 49758912 missense possibly damaging 0.53
R0760:Kif5c UTSW 2 49688753 missense probably damaging 1.00
R0967:Kif5c UTSW 2 49698116 unclassified probably benign
R1015:Kif5c UTSW 2 49744365 missense probably benign 0.13
R1758:Kif5c UTSW 2 49723133 missense probably benign 0.00
R1786:Kif5c UTSW 2 49758805 splice site probably benign
R1828:Kif5c UTSW 2 49680240 critical splice donor site probably null
R2130:Kif5c UTSW 2 49758805 splice site probably benign
R2132:Kif5c UTSW 2 49758805 splice site probably benign
R2237:Kif5c UTSW 2 49694008 missense probably benign 0.35
R3970:Kif5c UTSW 2 49688744 missense probably damaging 1.00
R4439:Kif5c UTSW 2 49688725 missense possibly damaging 0.90
R5318:Kif5c UTSW 2 49671828 missense probably benign
R5345:Kif5c UTSW 2 49723066 missense probably benign
R5490:Kif5c UTSW 2 49758858 missense probably benign
R5496:Kif5c UTSW 2 49730190 missense possibly damaging 0.69
R5567:Kif5c UTSW 2 49730199 missense possibly damaging 0.64
R5570:Kif5c UTSW 2 49730199 missense possibly damaging 0.64
R6019:Kif5c UTSW 2 49735509 missense probably benign 0.09
R6688:Kif5c UTSW 2 49688737 missense probably benign 0.06
R7006:Kif5c UTSW 2 49735514 missense probably damaging 0.97
R7009:Kif5c UTSW 2 49757429 missense probably benign
R7081:Kif5c UTSW 2 49741361 missense probably benign 0.00
R7372:Kif5c UTSW 2 49758659 splice site probably null
R7512:Kif5c UTSW 2 49700965 missense probably damaging 1.00
R7549:Kif5c UTSW 2 49701093 missense probably benign 0.11
R7764:Kif5c UTSW 2 49727961 critical splice donor site probably null
R7764:Kif5c UTSW 2 49749327 missense probably damaging 1.00
R7904:Kif5c UTSW 2 49701083 missense probably damaging 1.00
R8292:Kif5c UTSW 2 49735485 missense probably benign 0.05
R8735:Kif5c UTSW 2 49694771 missense probably damaging 1.00
R8816:Kif5c UTSW 2 49694787 missense probably damaging 1.00
R9109:Kif5c UTSW 2 49730139 missense probably damaging 1.00
R9139:Kif5c UTSW 2 49730279 missense probably benign 0.00
R9257:Kif5c UTSW 2 49700592 nonsense probably null
R9325:Kif5c UTSW 2 49749366 missense probably benign 0.04
R9368:Kif5c UTSW 2 49732780 missense probably damaging 0.99
R9748:Kif5c UTSW 2 49694847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACAATGTTTGCCCCAAAGC -3'
(R):5'- GGCTATCTTAAGGCCCACTC -3'

Sequencing Primer
(F):5'- ACCCATGGTTAGGGTTCACAGAC -3'
(R):5'- CTCATATAAGGCCGAGTGCACTG -3'
Posted On 2016-07-06