Mutagenetix > Incidental Mutation

Incidental Mutation 'R5260:Tchhl1'

401354

Institutional Source

Beutler Lab

Gene Symbol

Tchhl1

Ensembl Gene

ENSMUSG00000027908

Gene Name

trichohyalin-like 1

Synonyms

Thhl1, S100a17

MMRRC Submission

042829-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5260 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93468754-93471980 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 93470795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 269 (S269P)

Ref Sequence

ENSEMBL: ENSMUSP00000029516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029516]

AlphaFold

Q9D3P1

Predicted Effect

probably damaging
Transcript: ENSMUST00000029516
AA Change: S269P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029516
Gene: ENSMUSG00000027908
AA Change: S269P

Domain	Start	End	E-Value	Type
Pfam:S_100	4	47	1.2e-15	PFAM
low complexity region	111	124	N/A	INTRINSIC

Meta Mutation Damage Score

0.1185

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the S100 fused-type protein (SFTP) gene family, and is located in a cluster of SFTP genes on chromosome 1q21. Several members of this family have been implicated in the development of complex skin disorders. This gene is evolutionarily conserved; its expression appears to be hair-specific and spatially restricted within the distal inner root sheath of the hair follicle. It thus may have an important role in hair morphogenesis. [provided by RefSeq, Aug 2013]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	T	1: 93,159,978	V51E	probably damaging	Het
Abraxas2	A	T	7: 132,859,274	I14F	probably damaging	Het
Acin1	T	C	14: 54,642,822		probably benign	Het
Adamts9	C	A	6: 92,807,137	V1579L	probably benign	Het
Adra2a	T	A	19: 54,046,608	C132S	probably damaging	Het
Aif1	T	A	17: 35,171,941		probably null	Het
Atf5	A	T	7: 44,815,086	Y27*	probably null	Het
Atm	A	G	9: 53,506,611	S799P	probably damaging	Het
Bmp2k	T	G	5: 97,087,351		probably benign	Het
Chaf1a	C	T	17: 56,065,000	H723Y	probably damaging	Het
Clint1	T	C	11: 45,907,942	W493R	probably damaging	Het
Cyb561a3	T	A	19: 10,587,866	V198D	possibly damaging	Het
Cyp2j8	T	C	4: 96,501,064	E174G	possibly damaging	Het
Cyp4v3	C	T	8: 45,306,980	G512S	probably damaging	Het
Dnah8	T	A	17: 30,700,419	V1122D	probably benign	Het
Doc2b	C	A	11: 75,786,163	G128V	probably damaging	Het
Dysf	T	C	6: 84,150,034	V1378A	probably damaging	Het
Efcab5	A	T	11: 77,137,651	S421T	possibly damaging	Het
Efcab6	T	G	15: 83,945,123	D672A	probably benign	Het
Eif2ak3	C	A	6: 70,893,129	H933Q	probably damaging	Het
Erc1	A	T	6: 119,761,159	N574K	probably damaging	Het
Eri2	A	T	7: 119,787,846		probably benign	Het
Faxc	A	G	4: 21,948,744	Y152C	probably damaging	Het
Fbxl7	T	A	15: 26,543,499	Y354F	probably damaging	Het
Fras1	T	A	5: 96,735,187	I2526N	possibly damaging	Het
Gm1966	A	G	7: 106,599,204		noncoding transcript	Het
Gm5424	A	T	10: 62,071,595		noncoding transcript	Het
Gm6728	T	C	6: 136,486,703		noncoding transcript	Het
Golgb1	A	T	16: 36,913,141	S917C	probably benign	Het
Gtpbp3	T	C	8: 71,489,418		probably benign	Het
Gusb	A	T	5: 129,999,988	Y220*	probably null	Het
Hmcn1	A	G	1: 150,595,861	V4914A	possibly damaging	Het
Iars2	C	A	1: 185,323,734	C211F	probably damaging	Het
Kif5b	A	G	18: 6,211,058	L802P	probably damaging	Het
Kif5c	A	G	2: 49,735,590	E624G	probably damaging	Het
Kmt2d	G	T	15: 98,842,860		probably benign	Het
Krt82	C	A	15: 101,548,388	G186C	possibly damaging	Het
Lca5	G	A	9: 83,423,223	R177C	probably damaging	Het
Mier1	T	C	4: 103,162,710	S318P	probably benign	Het
Obscn	A	T	11: 59,003,369	I1207N	probably damaging	Het
Olfr1161	A	C	2: 88,025,474	I251L	probably benign	Het
Olfr1261	A	G	2: 89,994,182	D263G	probably damaging	Het
Olfr1302	A	G	2: 111,781,181	Y287C	probably damaging	Het
Olfr607	A	G	7: 103,460,615	F198L	probably benign	Het
Oog4	C	T	4: 143,437,854	G369D	probably benign	Het
Plec	T	C	15: 76,176,624	T3060A	probably damaging	Het
Plekhh2	C	T	17: 84,577,165	T769I	probably damaging	Het
Prkaa1	A	T	15: 5,160,668	S65C	probably damaging	Het
Psma3	T	C	12: 70,984,642		probably benign	Het
Ptpn18	T	A	1: 34,463,510		probably benign	Het
Ptprv	T	C	1: 135,112,260		noncoding transcript	Het
Rac1	C	A	5: 143,508,131	V104L	probably benign	Het
Serpinb7	A	T	1: 107,434,749	N61I	possibly damaging	Het
Sirt7	A	C	11: 120,620,521		probably benign	Het
Srl	G	A	16: 4,482,895	R333*	probably null	Het
Srprb	A	T	9: 103,201,920	L756Q	probably damaging	Het
Tdo2	C	T	3: 81,975,323		probably null	Het
Teddm1a	T	C	1: 153,891,900	Y37H	probably benign	Het
Tenm3	T	C	8: 48,236,855	Y1899C	probably damaging	Het
Tep1	T	C	14: 50,838,631	T1681A	probably benign	Het
Timm44	G	T	8: 4,275,919		probably null	Het
Trp73	A	G	4: 154,062,602	V322A	possibly damaging	Het
Tsr1	A	C	11: 74,905,955	E611A	probably damaging	Het
Unc80	A	G	1: 66,646,587	N2290S	possibly damaging	Het
Ush2a	T	C	1: 188,947,079	V4828A	possibly damaging	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wnt9b	C	A	11: 103,732,049	S176I	possibly damaging	Het
Zfp329	A	G	7: 12,806,526		probably benign	Het
Zfp352	T	A	4: 90,224,460	V279D	probably damaging	Het
Zfp932	C	T	5: 110,009,635	Q400*	probably null	Het
Zxdc	T	A	6: 90,382,093	L569Q	probably damaging	Het

Other mutations in Tchhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Tchhl1	APN	3	93470923	missense	probably benign	0.00
IGL00803:Tchhl1	APN	3	93470900	missense	probably benign	0.00
IGL01075:Tchhl1	APN	3	93470316	missense	probably damaging	1.00
IGL01814:Tchhl1	APN	3	93470349	missense	possibly damaging	0.53
IGL02026:Tchhl1	APN	3	93470555	missense	probably damaging	0.99
IGL02407:Tchhl1	APN	3	93471327	missense	possibly damaging	0.95
IGL03286:Tchhl1	APN	3	93471123	missense	probably benign	0.00
IGL03293:Tchhl1	APN	3	93470275	missense	probably damaging	1.00
Reef	UTSW	3	93471029	nonsense	probably null
R0371:Tchhl1	UTSW	3	93469577	missense	probably damaging	1.00
R0403:Tchhl1	UTSW	3	93471029	nonsense	probably null
R0763:Tchhl1	UTSW	3	93471571	missense	probably benign	0.05
R1052:Tchhl1	UTSW	3	93470213	missense	probably benign	0.32
R1848:Tchhl1	UTSW	3	93471101	missense	probably damaging	1.00
R4917:Tchhl1	UTSW	3	93470316	missense	possibly damaging	0.52
R4918:Tchhl1	UTSW	3	93470316	missense	possibly damaging	0.52
R4945:Tchhl1	UTSW	3	93471576	missense	probably benign	0.00
R5251:Tchhl1	UTSW	3	93470553	missense	possibly damaging	0.70
R5398:Tchhl1	UTSW	3	93471603	missense	probably benign	0.01
R5759:Tchhl1	UTSW	3	93471556	missense	probably damaging	1.00
R5760:Tchhl1	UTSW	3	93471556	missense	probably damaging	1.00
R5872:Tchhl1	UTSW	3	93470529	missense	probably benign	0.31
R6592:Tchhl1	UTSW	3	93470809	missense	probably damaging	0.99
R7464:Tchhl1	UTSW	3	93470664	missense	probably benign	0.01
R7653:Tchhl1	UTSW	3	93471144	missense	probably benign	0.01
R7726:Tchhl1	UTSW	3	93471758	missense	probably benign	0.07
R8487:Tchhl1	UTSW	3	93469562	missense	probably damaging	1.00
R9207:Tchhl1	UTSW	3	93470512	missense	possibly damaging	0.94
RF018:Tchhl1	UTSW	3	93470384	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGATGCTCAGGAAGTCGCAC -3'
(R):5'- TTCTTGTGCTGGCAATCCG -3'

Sequencing Primer
(F):5'- CCAGCAACTGAATATGATGGAGTCC -3'
(R):5'- GCAATCCGTGGCTCTCAG -3'

Posted On

2016-07-06