Incidental Mutation 'R5260:Bmp2k'
ID 401362
Institutional Source Beutler Lab
Gene Symbol Bmp2k
Ensembl Gene ENSMUSG00000034663
Gene Name BMP2 inducible kinase
Synonyms 4933417M22Rik, BIKE
MMRRC Submission 042829-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.182) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 97145548-97239726 bp(+) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to G at 97235210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035635] [ENSMUST00000069453] [ENSMUST00000112969]
AlphaFold Q91Z96
Predicted Effect unknown
Transcript: ENSMUST00000035635
AA Change: F878V
SMART Domains Protein: ENSMUSP00000037970
Gene: ENSMUSG00000034663
AA Change: F878V

DomainStartEndE-ValueType
low complexity region 12 37 N/A INTRINSIC
Pfam:Pkinase_Tyr 48 309 8.9e-27 PFAM
Pfam:Pkinase 48 311 1.6e-43 PFAM
coiled coil region 455 490 N/A INTRINSIC
low complexity region 511 538 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 838 852 N/A INTRINSIC
Pfam:BMP2K_C 873 1138 7.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069453
SMART Domains Protein: ENSMUSP00000069324
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 3.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112969
SMART Domains Protein: ENSMUSP00000108593
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 1.4e-51 PFAM
Meta Mutation Damage Score 0.2185 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human homolog of mouse BMP-2-inducible kinase. Bone morphogenic proteins (BMPs) play a key role in skeletal development and patterning. Expression of the mouse gene is increased during BMP-2 induced differentiation and the gene product is a putative serine/threonine protein kinase containing a nuclear localization signal. Therefore, the protein encoded by this human homolog is thought to be a protein kinase with a putative regulatory role in attenuating the program of osteoblast differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A T 7: 132,461,003 (GRCm39) I14F probably damaging Het
Acin1 T C 14: 54,880,279 (GRCm39) probably benign Het
Adamts9 C A 6: 92,784,118 (GRCm39) V1579L probably benign Het
Adra2a T A 19: 54,035,039 (GRCm39) C132S probably damaging Het
Aif1 T A 17: 35,390,917 (GRCm39) probably null Het
Atf5 A T 7: 44,464,510 (GRCm39) Y27* probably null Het
Atm A G 9: 53,417,911 (GRCm39) S799P probably damaging Het
Chaf1a C T 17: 56,372,000 (GRCm39) H723Y probably damaging Het
Clint1 T C 11: 45,798,769 (GRCm39) W493R probably damaging Het
Cyb561a3 T A 19: 10,565,230 (GRCm39) V198D possibly damaging Het
Cyp2j8 T C 4: 96,389,301 (GRCm39) E174G possibly damaging Het
Cyp4v3 C T 8: 45,760,017 (GRCm39) G512S probably damaging Het
Dnah8 T A 17: 30,919,393 (GRCm39) V1122D probably benign Het
Doc2b C A 11: 75,676,989 (GRCm39) G128V probably damaging Het
Dysf T C 6: 84,127,016 (GRCm39) V1378A probably damaging Het
Efcab5 A T 11: 77,028,477 (GRCm39) S421T possibly damaging Het
Efcab6 T G 15: 83,829,324 (GRCm39) D672A probably benign Het
Eif2ak3 C A 6: 70,870,113 (GRCm39) H933Q probably damaging Het
Erc1 A T 6: 119,738,120 (GRCm39) N574K probably damaging Het
Eri2 A T 7: 119,387,069 (GRCm39) probably benign Het
Faxc A G 4: 21,948,744 (GRCm39) Y152C probably damaging Het
Fbxl7 T A 15: 26,543,585 (GRCm39) Y354F probably damaging Het
Fras1 T A 5: 96,883,046 (GRCm39) I2526N possibly damaging Het
Gm5424 A T 10: 61,907,374 (GRCm39) noncoding transcript Het
Gm6728 T C 6: 136,463,701 (GRCm39) noncoding transcript Het
Golgb1 A T 16: 36,733,503 (GRCm39) S917C probably benign Het
Gtpbp3 T C 8: 71,942,062 (GRCm39) probably benign Het
Gusb A T 5: 130,028,829 (GRCm39) Y220* probably null Het
Gvin3 A G 7: 106,198,411 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,471,612 (GRCm39) V4914A possibly damaging Het
Iars2 C A 1: 185,055,931 (GRCm39) C211F probably damaging Het
Kif5b A G 18: 6,211,058 (GRCm39) L802P probably damaging Het
Kif5c A G 2: 49,625,602 (GRCm39) E624G probably damaging Het
Kmt2d G T 15: 98,740,741 (GRCm39) probably benign Het
Krt82 C A 15: 101,456,823 (GRCm39) G186C possibly damaging Het
Lca5 G A 9: 83,305,276 (GRCm39) R177C probably damaging Het
Mab21l4 A T 1: 93,087,700 (GRCm39) V51E probably damaging Het
Mier1 T C 4: 103,019,907 (GRCm39) S318P probably benign Het
Obscn A T 11: 58,894,195 (GRCm39) I1207N probably damaging Het
Oog4 C T 4: 143,164,424 (GRCm39) G369D probably benign Het
Or4c126 A G 2: 89,824,526 (GRCm39) D263G probably damaging Het
Or4k52 A G 2: 111,611,526 (GRCm39) Y287C probably damaging Het
Or52d13 A G 7: 103,109,822 (GRCm39) F198L probably benign Het
Or5d35 A C 2: 87,855,818 (GRCm39) I251L probably benign Het
Plec T C 15: 76,060,824 (GRCm39) T3060A probably damaging Het
Plekhh2 C T 17: 84,884,593 (GRCm39) T769I probably damaging Het
Prkaa1 A T 15: 5,190,149 (GRCm39) S65C probably damaging Het
Psma3 T C 12: 71,031,416 (GRCm39) probably benign Het
Ptpn18 T A 1: 34,502,591 (GRCm39) probably benign Het
Ptprv T C 1: 135,039,998 (GRCm39) noncoding transcript Het
Rac1 C A 5: 143,493,886 (GRCm39) V104L probably benign Het
Serpinb7 A T 1: 107,362,479 (GRCm39) N61I possibly damaging Het
Sirt7 A C 11: 120,511,347 (GRCm39) probably benign Het
Srl G A 16: 4,300,759 (GRCm39) R333* probably null Het
Srprb A T 9: 103,079,119 (GRCm39) L756Q probably damaging Het
Tchhl1 T C 3: 93,378,102 (GRCm39) S269P probably damaging Het
Tdo2 C T 3: 81,882,630 (GRCm39) probably null Het
Teddm1a T C 1: 153,767,646 (GRCm39) Y37H probably benign Het
Tenm3 T C 8: 48,689,890 (GRCm39) Y1899C probably damaging Het
Tep1 T C 14: 51,076,088 (GRCm39) T1681A probably benign Het
Timm44 G T 8: 4,325,919 (GRCm39) probably null Het
Trp73 A G 4: 154,147,059 (GRCm39) V322A possibly damaging Het
Tsr1 A C 11: 74,796,781 (GRCm39) E611A probably damaging Het
Unc80 A G 1: 66,685,746 (GRCm39) N2290S possibly damaging Het
Ush2a T C 1: 188,679,276 (GRCm39) V4828A possibly damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnt9b C A 11: 103,622,875 (GRCm39) S176I possibly damaging Het
Zfp329 A G 7: 12,540,453 (GRCm39) probably benign Het
Zfp352 T A 4: 90,112,697 (GRCm39) V279D probably damaging Het
Zfp932 C T 5: 110,157,501 (GRCm39) Q400* probably null Het
Zxdc T A 6: 90,359,075 (GRCm39) L569Q probably damaging Het
Other mutations in Bmp2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Bmp2k APN 5 97,211,407 (GRCm39) splice site probably null
IGL01408:Bmp2k APN 5 97,234,823 (GRCm39) nonsense probably null
IGL02146:Bmp2k APN 5 97,212,689 (GRCm39) missense unknown
IGL02232:Bmp2k APN 5 97,179,109 (GRCm39) splice site probably benign
3-1:Bmp2k UTSW 5 97,200,979 (GRCm39) missense possibly damaging 0.68
R0277:Bmp2k UTSW 5 97,235,682 (GRCm39) utr 3 prime probably benign
R0284:Bmp2k UTSW 5 97,216,314 (GRCm39) missense unknown
R0323:Bmp2k UTSW 5 97,235,682 (GRCm39) utr 3 prime probably benign
R0384:Bmp2k UTSW 5 97,178,984 (GRCm39) splice site probably benign
R0726:Bmp2k UTSW 5 97,235,353 (GRCm39) utr 3 prime probably benign
R1479:Bmp2k UTSW 5 97,201,059 (GRCm39) missense probably benign 0.16
R1686:Bmp2k UTSW 5 97,211,392 (GRCm39) missense unknown
R1826:Bmp2k UTSW 5 97,209,261 (GRCm39) splice site probably benign
R3842:Bmp2k UTSW 5 97,235,010 (GRCm39) utr 3 prime probably benign
R3919:Bmp2k UTSW 5 97,222,599 (GRCm39) missense unknown
R4649:Bmp2k UTSW 5 97,200,970 (GRCm39) missense possibly damaging 0.95
R4954:Bmp2k UTSW 5 97,234,623 (GRCm39) unclassified probably benign
R4975:Bmp2k UTSW 5 97,234,944 (GRCm39) utr 3 prime probably benign
R5001:Bmp2k UTSW 5 97,201,001 (GRCm39) missense probably damaging 1.00
R5122:Bmp2k UTSW 5 97,234,874 (GRCm39) utr 3 prime probably benign
R5516:Bmp2k UTSW 5 97,235,312 (GRCm39) utr 3 prime probably benign
R5762:Bmp2k UTSW 5 97,235,050 (GRCm39) frame shift probably null
R5807:Bmp2k UTSW 5 97,211,353 (GRCm39) missense unknown
R5835:Bmp2k UTSW 5 97,204,841 (GRCm39) missense possibly damaging 0.95
R5928:Bmp2k UTSW 5 97,235,595 (GRCm39) utr 3 prime probably benign
R6012:Bmp2k UTSW 5 97,211,467 (GRCm39) splice site probably null
R6546:Bmp2k UTSW 5 97,235,937 (GRCm39) missense probably benign 0.32
R6664:Bmp2k UTSW 5 97,235,989 (GRCm39) missense probably benign 0.03
R6962:Bmp2k UTSW 5 97,179,097 (GRCm39) nonsense probably null
R7081:Bmp2k UTSW 5 97,212,820 (GRCm39) missense unknown
R7267:Bmp2k UTSW 5 97,216,293 (GRCm39) missense unknown
R7473:Bmp2k UTSW 5 97,204,871 (GRCm39) missense probably benign 0.40
R7498:Bmp2k UTSW 5 97,235,978 (GRCm39) missense probably benign 0.03
R7659:Bmp2k UTSW 5 97,222,578 (GRCm39) missense unknown
R8331:Bmp2k UTSW 5 97,192,928 (GRCm39) missense probably damaging 1.00
R8334:Bmp2k UTSW 5 97,175,753 (GRCm39) missense possibly damaging 0.91
R9355:Bmp2k UTSW 5 97,211,366 (GRCm39) nonsense probably null
R9627:Bmp2k UTSW 5 97,201,028 (GRCm39) missense possibly damaging 0.50
X0026:Bmp2k UTSW 5 97,186,392 (GRCm39) missense probably damaging 1.00
Z1177:Bmp2k UTSW 5 97,201,015 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGACGACAAACACAGCTCTG -3'
(R):5'- TTTCCTCAAAGGGCACGAGC -3'

Sequencing Primer
(F):5'- AGAGGAGACACGAGCTCCC -3'
(R):5'- GAGCCCAAAAACATCCTCCTTG -3'
Posted On 2016-07-06