Incidental Mutation 'R5260:Bmp2k'
ID401362
Institutional Source Beutler Lab
Gene Symbol Bmp2k
Ensembl Gene ENSMUSG00000034663
Gene NameBMP2 inducible kinase
Synonyms4933417M22Rik, BIKE
MMRRC Submission 042829-MU
Accession Numbers

Genbank: NM_080708; MGI: 2155456

Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R5260 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location96997689-97091867 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to G at 97087351 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035635] [ENSMUST00000069453] [ENSMUST00000112969]
Predicted Effect unknown
Transcript: ENSMUST00000035635
AA Change: F878V
SMART Domains Protein: ENSMUSP00000037970
Gene: ENSMUSG00000034663
AA Change: F878V

DomainStartEndE-ValueType
low complexity region 12 37 N/A INTRINSIC
Pfam:Pkinase_Tyr 48 309 8.9e-27 PFAM
Pfam:Pkinase 48 311 1.6e-43 PFAM
coiled coil region 455 490 N/A INTRINSIC
low complexity region 511 538 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 838 852 N/A INTRINSIC
Pfam:BMP2K_C 873 1138 7.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069453
SMART Domains Protein: ENSMUSP00000069324
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 3.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112969
SMART Domains Protein: ENSMUSP00000108593
Gene: ENSMUSG00000055725

DomainStartEndE-ValueType
Pfam:HlyIII 64 289 1.4e-51 PFAM
Meta Mutation Damage Score 0.2185 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human homolog of mouse BMP-2-inducible kinase. Bone morphogenic proteins (BMPs) play a key role in skeletal development and patterning. Expression of the mouse gene is increased during BMP-2 induced differentiation and the gene product is a putative serine/threonine protein kinase containing a nuclear localization signal. Therefore, the protein encoded by this human homolog is thought to be a protein kinase with a putative regulatory role in attenuating the program of osteoblast differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Bmp2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Bmp2k APN 5 97063548 splice site probably null
IGL01408:Bmp2k APN 5 97086964 nonsense probably null
IGL02146:Bmp2k APN 5 97064830 missense unknown
IGL02232:Bmp2k APN 5 97031250 splice site probably benign
3-1:Bmp2k UTSW 5 97053120 missense possibly damaging 0.68
R0277:Bmp2k UTSW 5 97087823 utr 3 prime probably benign
R0284:Bmp2k UTSW 5 97068455 missense unknown
R0323:Bmp2k UTSW 5 97087823 utr 3 prime probably benign
R0384:Bmp2k UTSW 5 97031125 splice site probably benign
R0726:Bmp2k UTSW 5 97087494 utr 3 prime probably benign
R1479:Bmp2k UTSW 5 97053200 missense probably benign 0.16
R1686:Bmp2k UTSW 5 97063533 missense unknown
R1826:Bmp2k UTSW 5 97061402 splice site probably benign
R3842:Bmp2k UTSW 5 97087151 utr 3 prime probably benign
R3919:Bmp2k UTSW 5 97074740 missense unknown
R4649:Bmp2k UTSW 5 97053111 missense possibly damaging 0.95
R4954:Bmp2k UTSW 5 97086764 unclassified probably benign
R4975:Bmp2k UTSW 5 97087085 utr 3 prime probably benign
R5001:Bmp2k UTSW 5 97053142 missense probably damaging 1.00
R5122:Bmp2k UTSW 5 97087015 utr 3 prime probably benign
R5516:Bmp2k UTSW 5 97087453 utr 3 prime probably benign
R5762:Bmp2k UTSW 5 97087191 frame shift probably null
R5807:Bmp2k UTSW 5 97063494 missense unknown
R5835:Bmp2k UTSW 5 97056982 missense possibly damaging 0.95
R5928:Bmp2k UTSW 5 97087736 utr 3 prime probably benign
R6012:Bmp2k UTSW 5 97063608 intron probably null
R6546:Bmp2k UTSW 5 97088078 missense probably benign 0.32
R6664:Bmp2k UTSW 5 97088130 missense probably benign 0.03
R6962:Bmp2k UTSW 5 97031238 nonsense probably null
R7081:Bmp2k UTSW 5 97064961 missense unknown
R7267:Bmp2k UTSW 5 97068434 missense unknown
R7473:Bmp2k UTSW 5 97057012 missense probably benign 0.40
R7498:Bmp2k UTSW 5 97088119 missense probably benign 0.03
R7659:Bmp2k UTSW 5 97074719 missense unknown
X0026:Bmp2k UTSW 5 97038533 missense probably damaging 1.00
Z1177:Bmp2k UTSW 5 97053156 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGACGACAAACACAGCTCTG -3'
(R):5'- TTTCCTCAAAGGGCACGAGC -3'

Sequencing Primer
(F):5'- AGAGGAGACACGAGCTCCC -3'
(R):5'- GAGCCCAAAAACATCCTCCTTG -3'
Posted On2016-07-06