Incidental Mutation 'R5260:Zfp932'
ID 401363
Institutional Source Beutler Lab
Gene Symbol Zfp932
Ensembl Gene ENSMUSG00000066613
Gene Name zinc finger protein 932
Synonyms
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R5260 (G1)
Quality Score 212
Status Validated
Chromosome 5
Chromosomal Location 109996521-110010411 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 110009635 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 400 (Q400*)
Ref Sequence ENSEMBL: ENSMUSP00000140446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099484] [ENSMUST00000112536] [ENSMUST00000112540] [ENSMUST00000125213] [ENSMUST00000143639] [ENSMUST00000187241]
AlphaFold E9QAG8
Predicted Effect probably benign
Transcript: ENSMUST00000099484
SMART Domains Protein: ENSMUSP00000097083
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
KRAB 5 61 1.74e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112536
AA Change: Q367*
SMART Domains Protein: ENSMUSP00000108155
Gene: ENSMUSG00000066613
AA Change: Q367*

DomainStartEndE-ValueType
Blast:KRAB 1 31 5e-12 BLAST
ZnF_C2H2 71 93 1.1e-2 SMART
ZnF_C2H2 99 121 5.21e-4 SMART
ZnF_C2H2 127 149 3.39e-3 SMART
ZnF_C2H2 155 177 1.76e-1 SMART
ZnF_C2H2 183 205 1.3e-4 SMART
ZnF_C2H2 211 233 1.1e-2 SMART
ZnF_C2H2 239 261 2.27e-4 SMART
ZnF_C2H2 267 289 1.84e-4 SMART
ZnF_C2H2 295 317 5.21e-4 SMART
ZnF_C2H2 323 345 9.73e-4 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 1.58e-3 SMART
ZnF_C2H2 407 429 5.14e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
ZnF_C2H2 463 485 2.43e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112540
AA Change: Q400*
SMART Domains Protein: ENSMUSP00000108159
Gene: ENSMUSG00000066613
AA Change: Q400*

DomainStartEndE-ValueType
KRAB 5 61 1.74e-14 SMART
ZnF_C2H2 104 126 1.1e-2 SMART
ZnF_C2H2 132 154 5.21e-4 SMART
ZnF_C2H2 160 182 3.39e-3 SMART
ZnF_C2H2 188 210 1.76e-1 SMART
ZnF_C2H2 216 238 1.3e-4 SMART
ZnF_C2H2 244 266 1.1e-2 SMART
ZnF_C2H2 272 294 2.27e-4 SMART
ZnF_C2H2 300 322 1.84e-4 SMART
ZnF_C2H2 328 350 5.21e-4 SMART
ZnF_C2H2 356 378 9.73e-4 SMART
ZnF_C2H2 384 406 1.58e-3 SMART
ZnF_C2H2 412 434 1.58e-3 SMART
ZnF_C2H2 440 462 5.14e-3 SMART
ZnF_C2H2 468 490 2.61e-4 SMART
ZnF_C2H2 496 518 2.43e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125213
SMART Domains Protein: ENSMUSP00000119843
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-14 BLAST
ZnF_C2H2 71 93 1.1e-2 SMART
ZnF_C2H2 99 121 5.21e-4 SMART
ZnF_C2H2 127 149 3.39e-3 SMART
ZnF_C2H2 155 177 1.76e-1 SMART
Pfam:zf-C2H2_6 182 191 7.3e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143639
SMART Domains Protein: ENSMUSP00000121749
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
KRAB 4 60 1.74e-14 SMART
ZnF_C2H2 103 125 1.1e-2 SMART
ZnF_C2H2 131 153 5.21e-4 SMART
ZnF_C2H2 159 181 3.39e-3 SMART
ZnF_C2H2 187 209 1.76e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187241
AA Change: Q400*
SMART Domains Protein: ENSMUSP00000140446
Gene: ENSMUSG00000066613
AA Change: Q400*

DomainStartEndE-ValueType
KRAB 5 61 7.1e-17 SMART
ZnF_C2H2 104 126 4.8e-5 SMART
ZnF_C2H2 132 154 2.2e-6 SMART
ZnF_C2H2 160 182 1.5e-5 SMART
ZnF_C2H2 188 210 7.2e-4 SMART
ZnF_C2H2 216 238 5.4e-7 SMART
ZnF_C2H2 244 266 4.5e-5 SMART
ZnF_C2H2 272 294 9.2e-7 SMART
ZnF_C2H2 300 322 7.5e-7 SMART
ZnF_C2H2 328 350 2.1e-6 SMART
ZnF_C2H2 356 378 4e-6 SMART
ZnF_C2H2 384 406 6.5e-6 SMART
ZnF_C2H2 412 434 6.9e-6 SMART
ZnF_C2H2 440 462 2.1e-5 SMART
ZnF_C2H2 468 490 1.1e-6 SMART
ZnF_C2H2 496 518 1.1e-6 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Zfp932
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0153:Zfp932 UTSW 5 110006968 missense probably benign 0.27
R0268:Zfp932 UTSW 5 110009063 missense probably benign 0.24
R1673:Zfp932 UTSW 5 110008988 missense probably damaging 1.00
R1797:Zfp932 UTSW 5 109996623 start gained probably benign
R1893:Zfp932 UTSW 5 110009203 missense possibly damaging 0.71
R1942:Zfp932 UTSW 5 110006987 missense probably damaging 1.00
R2073:Zfp932 UTSW 5 110009818 missense possibly damaging 0.60
R2076:Zfp932 UTSW 5 110009468 missense probably benign 0.01
R2329:Zfp932 UTSW 5 110009540 missense probably benign 0.01
R3944:Zfp932 UTSW 5 110009954 missense probably benign 0.37
R4551:Zfp932 UTSW 5 110009639 missense probably benign 0.03
R4679:Zfp932 UTSW 5 110009894 missense probably damaging 1.00
R4692:Zfp932 UTSW 5 110009186 missense probably damaging 1.00
R5116:Zfp932 UTSW 5 110009376 missense probably benign 0.05
R5536:Zfp932 UTSW 5 110009847 nonsense probably null
R6351:Zfp932 UTSW 5 110009343 nonsense probably null
R6786:Zfp932 UTSW 5 110009740 missense probably damaging 0.98
R6843:Zfp932 UTSW 5 110008715 missense probably benign 0.02
R7437:Zfp932 UTSW 5 110010014 missense probably benign 0.10
R7496:Zfp932 UTSW 5 110008828 missense probably damaging 0.97
R7704:Zfp932 UTSW 5 110009764 missense probably benign 0.09
R8224:Zfp932 UTSW 5 109996614 start gained probably benign
R8317:Zfp932 UTSW 5 110009056 nonsense probably null
R8765:Zfp932 UTSW 5 110006961 missense probably benign 0.01
R8967:Zfp932 UTSW 5 110009017 missense probably benign 0.00
R9083:Zfp932 UTSW 5 110009234 missense probably damaging 1.00
R9142:Zfp932 UTSW 5 110009654 missense probably damaging 1.00
R9511:Zfp932 UTSW 5 110007311 missense possibly damaging 0.46
R9533:Zfp932 UTSW 5 110009921 missense probably damaging 1.00
R9640:Zfp932 UTSW 5 110009198 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTTATGAATGTAAGCAGTGTACT -3'
(R):5'- CATTCATAGGGCTTCTCTCCAGT -3'

Sequencing Primer
(F):5'- AGCAGTGTACTAAATCCTTTGCC -3'
(R):5'- CATAGGGCTTCTCTCCAGTATGTG -3'
Posted On 2016-07-06