Incidental Mutation 'R5260:Rac1'
ID 401365
Institutional Source Beutler Lab
Gene Symbol Rac1
Ensembl Gene ENSMUSG00000001847
Gene Name Rac family small GTPase 1
Synonyms D5Ertd559e
MMRRC Submission 042829-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 143491236-143513786 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 143493886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 104 (V104L)
Ref Sequence ENSEMBL: ENSMUSP00000098058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045593] [ENSMUST00000080537] [ENSMUST00000100489]
AlphaFold P63001
Predicted Effect probably benign
Transcript: ENSMUST00000045593
SMART Domains Protein: ENSMUSP00000043088
Gene: ENSMUSG00000039206

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
Pfam:Lipase_3 370 505 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080537
AA Change: V85L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000079380
Gene: ENSMUSG00000001847
AA Change: V85L

DomainStartEndE-ValueType
RHO 6 179 1.6e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100489
AA Change: V104L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000098058
Gene: ENSMUSG00000001847
AA Change: V104L

DomainStartEndE-ValueType
RHO 6 198 2.4e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145709
Meta Mutation Damage Score 0.1427 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit embryonic lethality prior to embryonic day 9.5 with defects in gastrulation. Neutrophil specific knockout mice show defects in inflammatory recruitment and chemotactic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A T 7: 132,461,003 (GRCm39) I14F probably damaging Het
Acin1 T C 14: 54,880,279 (GRCm39) probably benign Het
Adamts9 C A 6: 92,784,118 (GRCm39) V1579L probably benign Het
Adra2a T A 19: 54,035,039 (GRCm39) C132S probably damaging Het
Aif1 T A 17: 35,390,917 (GRCm39) probably null Het
Atf5 A T 7: 44,464,510 (GRCm39) Y27* probably null Het
Atm A G 9: 53,417,911 (GRCm39) S799P probably damaging Het
Bmp2k T G 5: 97,235,210 (GRCm39) probably benign Het
Chaf1a C T 17: 56,372,000 (GRCm39) H723Y probably damaging Het
Clint1 T C 11: 45,798,769 (GRCm39) W493R probably damaging Het
Cyb561a3 T A 19: 10,565,230 (GRCm39) V198D possibly damaging Het
Cyp2j8 T C 4: 96,389,301 (GRCm39) E174G possibly damaging Het
Cyp4v3 C T 8: 45,760,017 (GRCm39) G512S probably damaging Het
Dnah8 T A 17: 30,919,393 (GRCm39) V1122D probably benign Het
Doc2b C A 11: 75,676,989 (GRCm39) G128V probably damaging Het
Dysf T C 6: 84,127,016 (GRCm39) V1378A probably damaging Het
Efcab5 A T 11: 77,028,477 (GRCm39) S421T possibly damaging Het
Efcab6 T G 15: 83,829,324 (GRCm39) D672A probably benign Het
Eif2ak3 C A 6: 70,870,113 (GRCm39) H933Q probably damaging Het
Erc1 A T 6: 119,738,120 (GRCm39) N574K probably damaging Het
Eri2 A T 7: 119,387,069 (GRCm39) probably benign Het
Faxc A G 4: 21,948,744 (GRCm39) Y152C probably damaging Het
Fbxl7 T A 15: 26,543,585 (GRCm39) Y354F probably damaging Het
Fras1 T A 5: 96,883,046 (GRCm39) I2526N possibly damaging Het
Gm5424 A T 10: 61,907,374 (GRCm39) noncoding transcript Het
Gm6728 T C 6: 136,463,701 (GRCm39) noncoding transcript Het
Golgb1 A T 16: 36,733,503 (GRCm39) S917C probably benign Het
Gtpbp3 T C 8: 71,942,062 (GRCm39) probably benign Het
Gusb A T 5: 130,028,829 (GRCm39) Y220* probably null Het
Gvin3 A G 7: 106,198,411 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,471,612 (GRCm39) V4914A possibly damaging Het
Iars2 C A 1: 185,055,931 (GRCm39) C211F probably damaging Het
Kif5b A G 18: 6,211,058 (GRCm39) L802P probably damaging Het
Kif5c A G 2: 49,625,602 (GRCm39) E624G probably damaging Het
Kmt2d G T 15: 98,740,741 (GRCm39) probably benign Het
Krt82 C A 15: 101,456,823 (GRCm39) G186C possibly damaging Het
Lca5 G A 9: 83,305,276 (GRCm39) R177C probably damaging Het
Mab21l4 A T 1: 93,087,700 (GRCm39) V51E probably damaging Het
Mier1 T C 4: 103,019,907 (GRCm39) S318P probably benign Het
Obscn A T 11: 58,894,195 (GRCm39) I1207N probably damaging Het
Oog4 C T 4: 143,164,424 (GRCm39) G369D probably benign Het
Or4c126 A G 2: 89,824,526 (GRCm39) D263G probably damaging Het
Or4k52 A G 2: 111,611,526 (GRCm39) Y287C probably damaging Het
Or52d13 A G 7: 103,109,822 (GRCm39) F198L probably benign Het
Or5d35 A C 2: 87,855,818 (GRCm39) I251L probably benign Het
Plec T C 15: 76,060,824 (GRCm39) T3060A probably damaging Het
Plekhh2 C T 17: 84,884,593 (GRCm39) T769I probably damaging Het
Prkaa1 A T 15: 5,190,149 (GRCm39) S65C probably damaging Het
Psma3 T C 12: 71,031,416 (GRCm39) probably benign Het
Ptpn18 T A 1: 34,502,591 (GRCm39) probably benign Het
Ptprv T C 1: 135,039,998 (GRCm39) noncoding transcript Het
Serpinb7 A T 1: 107,362,479 (GRCm39) N61I possibly damaging Het
Sirt7 A C 11: 120,511,347 (GRCm39) probably benign Het
Srl G A 16: 4,300,759 (GRCm39) R333* probably null Het
Srprb A T 9: 103,079,119 (GRCm39) L756Q probably damaging Het
Tchhl1 T C 3: 93,378,102 (GRCm39) S269P probably damaging Het
Tdo2 C T 3: 81,882,630 (GRCm39) probably null Het
Teddm1a T C 1: 153,767,646 (GRCm39) Y37H probably benign Het
Tenm3 T C 8: 48,689,890 (GRCm39) Y1899C probably damaging Het
Tep1 T C 14: 51,076,088 (GRCm39) T1681A probably benign Het
Timm44 G T 8: 4,325,919 (GRCm39) probably null Het
Trp73 A G 4: 154,147,059 (GRCm39) V322A possibly damaging Het
Tsr1 A C 11: 74,796,781 (GRCm39) E611A probably damaging Het
Unc80 A G 1: 66,685,746 (GRCm39) N2290S possibly damaging Het
Ush2a T C 1: 188,679,276 (GRCm39) V4828A possibly damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnt9b C A 11: 103,622,875 (GRCm39) S176I possibly damaging Het
Zfp329 A G 7: 12,540,453 (GRCm39) probably benign Het
Zfp352 T A 4: 90,112,697 (GRCm39) V279D probably damaging Het
Zfp932 C T 5: 110,157,501 (GRCm39) Q400* probably null Het
Zxdc T A 6: 90,359,075 (GRCm39) L569Q probably damaging Het
Other mutations in Rac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Rac1 APN 5 143,493,093 (GRCm39) missense possibly damaging 0.86
R1496:Rac1 UTSW 5 143,493,093 (GRCm39) missense probably damaging 0.99
R1824:Rac1 UTSW 5 143,502,980 (GRCm39) missense probably benign 0.03
R4905:Rac1 UTSW 5 143,502,907 (GRCm39) splice site probably null
R5992:Rac1 UTSW 5 143,492,753 (GRCm39) unclassified probably benign
R8885:Rac1 UTSW 5 143,493,885 (GRCm39) missense probably damaging 0.96
R9595:Rac1 UTSW 5 143,513,643 (GRCm39) start gained probably benign
Z1088:Rac1 UTSW 5 143,500,474 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCCCAATGAAGCTCCAGAG -3'
(R):5'- TTTGAGTCTCTGGCCGACTG -3'

Sequencing Primer
(F):5'- AGTCAGAGACTTAAAAATGGCCC -3'
(R):5'- TCTGGCCGACTGGAGAGGTAG -3'
Posted On 2016-07-06