Incidental Mutation 'R5260:Rac1'
ID 401365
Institutional Source Beutler Lab
Gene Symbol Rac1
Ensembl Gene ENSMUSG00000001847
Gene Name Rac family small GTPase 1
Synonyms D5Ertd559e
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 143503634-143528036 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 143508131 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 104 (V104L)
Ref Sequence ENSEMBL: ENSMUSP00000098058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045593] [ENSMUST00000080537] [ENSMUST00000100489]
AlphaFold P63001
Predicted Effect probably benign
Transcript: ENSMUST00000045593
SMART Domains Protein: ENSMUSP00000043088
Gene: ENSMUSG00000039206

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
Pfam:Lipase_3 370 505 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080537
AA Change: V85L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000079380
Gene: ENSMUSG00000001847
AA Change: V85L

DomainStartEndE-ValueType
RHO 6 179 1.6e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100489
AA Change: V104L

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000098058
Gene: ENSMUSG00000001847
AA Change: V104L

DomainStartEndE-ValueType
RHO 6 198 2.4e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145709
Meta Mutation Damage Score 0.1427 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit embryonic lethality prior to embryonic day 9.5 with defects in gastrulation. Neutrophil specific knockout mice show defects in inflammatory recruitment and chemotactic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Rac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Rac1 APN 5 143507338 missense possibly damaging 0.86
R1496:Rac1 UTSW 5 143507338 missense probably damaging 0.99
R1824:Rac1 UTSW 5 143517225 missense probably benign 0.03
R4905:Rac1 UTSW 5 143517152 splice site probably null
R5992:Rac1 UTSW 5 143506998 unclassified probably benign
R8885:Rac1 UTSW 5 143508130 missense probably damaging 0.96
R9595:Rac1 UTSW 5 143527888 start gained probably benign
Z1088:Rac1 UTSW 5 143514719 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCCCAATGAAGCTCCAGAG -3'
(R):5'- TTTGAGTCTCTGGCCGACTG -3'

Sequencing Primer
(F):5'- AGTCAGAGACTTAAAAATGGCCC -3'
(R):5'- TCTGGCCGACTGGAGAGGTAG -3'
Posted On 2016-07-06