Incidental Mutation 'R5260:Eif2ak3'
ID 401367
Institutional Source Beutler Lab
Gene Symbol Eif2ak3
Ensembl Gene ENSMUSG00000031668
Gene Name eukaryotic translation initiation factor 2 alpha kinase 3
Synonyms PERK
MMRRC Submission 042829-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.650) question?
Stock # R5260 (G1)
Quality Score 138
Status Validated
Chromosome 6
Chromosomal Location 70821499-70882229 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70870113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 933 (H933Q)
Ref Sequence ENSEMBL: ENSMUSP00000034093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034093]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034093
AA Change: H933Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034093
Gene: ENSMUSG00000031668
AA Change: H933Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 48 82 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 221 230 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Pfam:Pkinase_Tyr 589 662 1.6e-6 PFAM
Pfam:Pkinase 589 673 3.2e-12 PFAM
Pfam:Pkinase 839 1075 1.9e-38 PFAM
Pfam:Pkinase_Tyr 859 1073 5.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161316
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: The protein encoded by this gene phosphorylates the alpha subunit of eukaryotic translation-initiation factor 2, leading to its inactivation, and thus to a rapid reduction of translational initiation and repression of global protein synthesis. This protein is thought to modulate mitochondrial function. It is a type I membrane protein located in the endoplasmic reticulum (ER), where it is induced by ER stress caused by malfolded proteins. Mutations in a similar gene in human are associated with Wolcott-Rallison syndrome. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice develop exocrine pancreatic insufficiency and progressive diabetes mellitus. They are growth retarded, hyperglycemic, exhibit increased cell death in the pancreas, have decreased numbers of pancreatic beta cells and about half diebefore weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A T 7: 132,461,003 (GRCm39) I14F probably damaging Het
Acin1 T C 14: 54,880,279 (GRCm39) probably benign Het
Adamts9 C A 6: 92,784,118 (GRCm39) V1579L probably benign Het
Adra2a T A 19: 54,035,039 (GRCm39) C132S probably damaging Het
Aif1 T A 17: 35,390,917 (GRCm39) probably null Het
Atf5 A T 7: 44,464,510 (GRCm39) Y27* probably null Het
Atm A G 9: 53,417,911 (GRCm39) S799P probably damaging Het
Bmp2k T G 5: 97,235,210 (GRCm39) probably benign Het
Chaf1a C T 17: 56,372,000 (GRCm39) H723Y probably damaging Het
Clint1 T C 11: 45,798,769 (GRCm39) W493R probably damaging Het
Cyb561a3 T A 19: 10,565,230 (GRCm39) V198D possibly damaging Het
Cyp2j8 T C 4: 96,389,301 (GRCm39) E174G possibly damaging Het
Cyp4v3 C T 8: 45,760,017 (GRCm39) G512S probably damaging Het
Dnah8 T A 17: 30,919,393 (GRCm39) V1122D probably benign Het
Doc2b C A 11: 75,676,989 (GRCm39) G128V probably damaging Het
Dysf T C 6: 84,127,016 (GRCm39) V1378A probably damaging Het
Efcab5 A T 11: 77,028,477 (GRCm39) S421T possibly damaging Het
Efcab6 T G 15: 83,829,324 (GRCm39) D672A probably benign Het
Erc1 A T 6: 119,738,120 (GRCm39) N574K probably damaging Het
Eri2 A T 7: 119,387,069 (GRCm39) probably benign Het
Faxc A G 4: 21,948,744 (GRCm39) Y152C probably damaging Het
Fbxl7 T A 15: 26,543,585 (GRCm39) Y354F probably damaging Het
Fras1 T A 5: 96,883,046 (GRCm39) I2526N possibly damaging Het
Gm5424 A T 10: 61,907,374 (GRCm39) noncoding transcript Het
Gm6728 T C 6: 136,463,701 (GRCm39) noncoding transcript Het
Golgb1 A T 16: 36,733,503 (GRCm39) S917C probably benign Het
Gtpbp3 T C 8: 71,942,062 (GRCm39) probably benign Het
Gusb A T 5: 130,028,829 (GRCm39) Y220* probably null Het
Gvin3 A G 7: 106,198,411 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,471,612 (GRCm39) V4914A possibly damaging Het
Iars2 C A 1: 185,055,931 (GRCm39) C211F probably damaging Het
Kif5b A G 18: 6,211,058 (GRCm39) L802P probably damaging Het
Kif5c A G 2: 49,625,602 (GRCm39) E624G probably damaging Het
Kmt2d G T 15: 98,740,741 (GRCm39) probably benign Het
Krt82 C A 15: 101,456,823 (GRCm39) G186C possibly damaging Het
Lca5 G A 9: 83,305,276 (GRCm39) R177C probably damaging Het
Mab21l4 A T 1: 93,087,700 (GRCm39) V51E probably damaging Het
Mier1 T C 4: 103,019,907 (GRCm39) S318P probably benign Het
Obscn A T 11: 58,894,195 (GRCm39) I1207N probably damaging Het
Oog4 C T 4: 143,164,424 (GRCm39) G369D probably benign Het
Or4c126 A G 2: 89,824,526 (GRCm39) D263G probably damaging Het
Or4k52 A G 2: 111,611,526 (GRCm39) Y287C probably damaging Het
Or52d13 A G 7: 103,109,822 (GRCm39) F198L probably benign Het
Or5d35 A C 2: 87,855,818 (GRCm39) I251L probably benign Het
Plec T C 15: 76,060,824 (GRCm39) T3060A probably damaging Het
Plekhh2 C T 17: 84,884,593 (GRCm39) T769I probably damaging Het
Prkaa1 A T 15: 5,190,149 (GRCm39) S65C probably damaging Het
Psma3 T C 12: 71,031,416 (GRCm39) probably benign Het
Ptpn18 T A 1: 34,502,591 (GRCm39) probably benign Het
Ptprv T C 1: 135,039,998 (GRCm39) noncoding transcript Het
Rac1 C A 5: 143,493,886 (GRCm39) V104L probably benign Het
Serpinb7 A T 1: 107,362,479 (GRCm39) N61I possibly damaging Het
Sirt7 A C 11: 120,511,347 (GRCm39) probably benign Het
Srl G A 16: 4,300,759 (GRCm39) R333* probably null Het
Srprb A T 9: 103,079,119 (GRCm39) L756Q probably damaging Het
Tchhl1 T C 3: 93,378,102 (GRCm39) S269P probably damaging Het
Tdo2 C T 3: 81,882,630 (GRCm39) probably null Het
Teddm1a T C 1: 153,767,646 (GRCm39) Y37H probably benign Het
Tenm3 T C 8: 48,689,890 (GRCm39) Y1899C probably damaging Het
Tep1 T C 14: 51,076,088 (GRCm39) T1681A probably benign Het
Timm44 G T 8: 4,325,919 (GRCm39) probably null Het
Trp73 A G 4: 154,147,059 (GRCm39) V322A possibly damaging Het
Tsr1 A C 11: 74,796,781 (GRCm39) E611A probably damaging Het
Unc80 A G 1: 66,685,746 (GRCm39) N2290S possibly damaging Het
Ush2a T C 1: 188,679,276 (GRCm39) V4828A possibly damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnt9b C A 11: 103,622,875 (GRCm39) S176I possibly damaging Het
Zfp329 A G 7: 12,540,453 (GRCm39) probably benign Het
Zfp352 T A 4: 90,112,697 (GRCm39) V279D probably damaging Het
Zfp932 C T 5: 110,157,501 (GRCm39) Q400* probably null Het
Zxdc T A 6: 90,359,075 (GRCm39) L569Q probably damaging Het
Other mutations in Eif2ak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Eif2ak3 APN 6 70,869,710 (GRCm39) missense probably damaging 1.00
IGL02069:Eif2ak3 APN 6 70,873,949 (GRCm39) missense probably damaging 1.00
IGL02197:Eif2ak3 APN 6 70,878,441 (GRCm39) missense probably benign 0.37
IGL03150:Eif2ak3 APN 6 70,869,420 (GRCm39) missense possibly damaging 0.68
R0024:Eif2ak3 UTSW 6 70,869,340 (GRCm39) missense probably benign 0.01
R0130:Eif2ak3 UTSW 6 70,858,716 (GRCm39) splice site probably benign
R0394:Eif2ak3 UTSW 6 70,862,202 (GRCm39) missense probably benign 0.03
R0699:Eif2ak3 UTSW 6 70,869,514 (GRCm39) missense probably benign 0.16
R1648:Eif2ak3 UTSW 6 70,860,615 (GRCm39) missense possibly damaging 0.52
R1708:Eif2ak3 UTSW 6 70,864,790 (GRCm39) missense probably damaging 0.99
R1953:Eif2ak3 UTSW 6 70,869,538 (GRCm39) missense probably benign 0.03
R2062:Eif2ak3 UTSW 6 70,881,181 (GRCm39) missense probably benign 0.02
R2875:Eif2ak3 UTSW 6 70,860,623 (GRCm39) missense probably damaging 1.00
R4260:Eif2ak3 UTSW 6 70,866,497 (GRCm39) missense probably damaging 0.98
R4357:Eif2ak3 UTSW 6 70,861,859 (GRCm39) missense probably damaging 0.98
R4786:Eif2ak3 UTSW 6 70,869,602 (GRCm39) missense possibly damaging 0.95
R4801:Eif2ak3 UTSW 6 70,864,877 (GRCm39) missense probably benign 0.01
R4802:Eif2ak3 UTSW 6 70,864,877 (GRCm39) missense probably benign 0.01
R5194:Eif2ak3 UTSW 6 70,835,462 (GRCm39) missense possibly damaging 0.83
R5710:Eif2ak3 UTSW 6 70,860,717 (GRCm39) missense probably damaging 1.00
R5724:Eif2ak3 UTSW 6 70,853,824 (GRCm39) missense probably benign 0.19
R6089:Eif2ak3 UTSW 6 70,873,918 (GRCm39) missense possibly damaging 0.87
R6656:Eif2ak3 UTSW 6 70,860,699 (GRCm39) missense probably damaging 1.00
R6940:Eif2ak3 UTSW 6 70,869,386 (GRCm39) missense possibly damaging 0.82
R6949:Eif2ak3 UTSW 6 70,855,829 (GRCm39) missense probably damaging 0.99
R6958:Eif2ak3 UTSW 6 70,869,667 (GRCm39) missense probably benign 0.01
R7168:Eif2ak3 UTSW 6 70,858,610 (GRCm39) missense probably benign
R7627:Eif2ak3 UTSW 6 70,869,919 (GRCm39) missense probably benign 0.01
R8322:Eif2ak3 UTSW 6 70,855,903 (GRCm39) missense probably damaging 1.00
R8693:Eif2ak3 UTSW 6 70,858,535 (GRCm39) missense possibly damaging 0.94
R8729:Eif2ak3 UTSW 6 70,821,864 (GRCm39) missense probably benign 0.00
R8924:Eif2ak3 UTSW 6 70,870,003 (GRCm39) missense probably damaging 1.00
R9127:Eif2ak3 UTSW 6 70,860,704 (GRCm39) missense probably damaging 1.00
R9156:Eif2ak3 UTSW 6 70,860,614 (GRCm39) missense probably damaging 1.00
R9171:Eif2ak3 UTSW 6 70,835,419 (GRCm39) missense probably damaging 1.00
R9608:Eif2ak3 UTSW 6 70,841,511 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACCAAGAACACTGTGGGC -3'
(R):5'- GCTGGAATTTAGATATGAGATCTTCCC -3'

Sequencing Primer
(F):5'- AAGAACACTGTGGGCCAGCTC -3'
(R):5'- CATCGGGACTGCTGGAAAC -3'
Posted On 2016-07-06