Incidental Mutation 'R5260:Eif2ak3'
ID 401367
Institutional Source Beutler Lab
Gene Symbol Eif2ak3
Ensembl Gene ENSMUSG00000031668
Gene Name eukaryotic translation initiation factor 2 alpha kinase 3
Synonyms PERK
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.706) question?
Stock # R5260 (G1)
Quality Score 138
Status Validated
Chromosome 6
Chromosomal Location 70844515-70905245 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70893129 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 933 (H933Q)
Ref Sequence ENSEMBL: ENSMUSP00000034093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034093]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034093
AA Change: H933Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034093
Gene: ENSMUSG00000031668
AA Change: H933Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 48 82 N/A INTRINSIC
low complexity region 125 139 N/A INTRINSIC
low complexity region 221 230 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Pfam:Pkinase_Tyr 589 662 1.6e-6 PFAM
Pfam:Pkinase 589 673 3.2e-12 PFAM
Pfam:Pkinase 839 1075 1.9e-38 PFAM
Pfam:Pkinase_Tyr 859 1073 5.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161316
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: The protein encoded by this gene phosphorylates the alpha subunit of eukaryotic translation-initiation factor 2, leading to its inactivation, and thus to a rapid reduction of translational initiation and repression of global protein synthesis. This protein is thought to modulate mitochondrial function. It is a type I membrane protein located in the endoplasmic reticulum (ER), where it is induced by ER stress caused by malfolded proteins. Mutations in a similar gene in human are associated with Wolcott-Rallison syndrome. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant mice develop exocrine pancreatic insufficiency and progressive diabetes mellitus. They are growth retarded, hyperglycemic, exhibit increased cell death in the pancreas, have decreased numbers of pancreatic beta cells and about half diebefore weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Eif2ak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Eif2ak3 APN 6 70892726 missense probably damaging 1.00
IGL02069:Eif2ak3 APN 6 70896965 missense probably damaging 1.00
IGL02197:Eif2ak3 APN 6 70901457 missense probably benign 0.37
IGL03150:Eif2ak3 APN 6 70892436 missense possibly damaging 0.68
R0024:Eif2ak3 UTSW 6 70892356 missense probably benign 0.01
R0130:Eif2ak3 UTSW 6 70881732 splice site probably benign
R0394:Eif2ak3 UTSW 6 70885218 missense probably benign 0.03
R0699:Eif2ak3 UTSW 6 70892530 missense probably benign 0.16
R1648:Eif2ak3 UTSW 6 70883631 missense possibly damaging 0.52
R1708:Eif2ak3 UTSW 6 70887806 missense probably damaging 0.99
R1953:Eif2ak3 UTSW 6 70892554 missense probably benign 0.03
R2062:Eif2ak3 UTSW 6 70904197 missense probably benign 0.02
R2875:Eif2ak3 UTSW 6 70883639 missense probably damaging 1.00
R4260:Eif2ak3 UTSW 6 70889513 missense probably damaging 0.98
R4357:Eif2ak3 UTSW 6 70884875 missense probably damaging 0.98
R4786:Eif2ak3 UTSW 6 70892618 missense possibly damaging 0.95
R4801:Eif2ak3 UTSW 6 70887893 missense probably benign 0.01
R4802:Eif2ak3 UTSW 6 70887893 missense probably benign 0.01
R5194:Eif2ak3 UTSW 6 70858478 missense possibly damaging 0.83
R5710:Eif2ak3 UTSW 6 70883733 missense probably damaging 1.00
R5724:Eif2ak3 UTSW 6 70876840 missense probably benign 0.19
R6089:Eif2ak3 UTSW 6 70896934 missense possibly damaging 0.87
R6656:Eif2ak3 UTSW 6 70883715 missense probably damaging 1.00
R6940:Eif2ak3 UTSW 6 70892402 missense possibly damaging 0.82
R6949:Eif2ak3 UTSW 6 70878845 missense probably damaging 0.99
R6958:Eif2ak3 UTSW 6 70892683 missense probably benign 0.01
R7168:Eif2ak3 UTSW 6 70881626 missense probably benign
R7627:Eif2ak3 UTSW 6 70892935 missense probably benign 0.01
R8322:Eif2ak3 UTSW 6 70878919 missense probably damaging 1.00
R8693:Eif2ak3 UTSW 6 70881551 missense possibly damaging 0.94
R8729:Eif2ak3 UTSW 6 70844880 missense probably benign 0.00
R8924:Eif2ak3 UTSW 6 70893019 missense probably damaging 1.00
R9127:Eif2ak3 UTSW 6 70883720 missense probably damaging 1.00
R9156:Eif2ak3 UTSW 6 70883630 missense probably damaging 1.00
R9171:Eif2ak3 UTSW 6 70858435 missense probably damaging 1.00
R9608:Eif2ak3 UTSW 6 70864527 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACCAAGAACACTGTGGGC -3'
(R):5'- GCTGGAATTTAGATATGAGATCTTCCC -3'

Sequencing Primer
(F):5'- AAGAACACTGTGGGCCAGCTC -3'
(R):5'- CATCGGGACTGCTGGAAAC -3'
Posted On 2016-07-06