Mutagenetix > Incidental Mutation

Incidental Mutation 'R5260:Adamts9'

401369

Institutional Source

Beutler Lab

Gene Symbol

Adamts9

Ensembl Gene

ENSMUSG00000030022

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9

Synonyms

8430403M15Rik, E030027K14Rik, 1810011L16Rik

MMRRC Submission

042829-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5260 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92772699-92943492 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 92807137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1579 (V1579L)

Ref Sequence

ENSEMBL: ENSMUSP00000109065 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]

AlphaFold

E9PUN6

Predicted Effect

probably benign
Transcript: ENSMUST00000113438
AA Change: V1579L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: V1579L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	49	207	1.8e-37	PFAM
low complexity region	234	247	N/A	INTRINSIC
Pfam:Reprolysin_5	291	476	7.6e-17	PFAM
Pfam:Reprolysin_4	291	495	2e-11	PFAM
Pfam:Reprolysin	293	499	7.4e-29	PFAM
Pfam:Reprolysin_2	310	489	1e-13	PFAM
Pfam:Reprolysin_3	314	445	1.7e-14	PFAM
TSP1	591	643	2.15e-9	SMART
Pfam:ADAM_spacer1	753	871	7.3e-35	PFAM
TSP1	881	936	1.14e0	SMART
Blast:TSP1	938	993	2e-28	BLAST
TSP1	1000	1054	3.78e-5	SMART
TSP1	1055	1109	5.64e-4	SMART
TSP1	1110	1166	1.25e-5	SMART
TSP1	1186	1240	1.45e-6	SMART
TSP1	1242	1296	4.41e-6	SMART
TSP1	1328	1380	7.06e-5	SMART
TSP1	1381	1436	4.24e-8	SMART
TSP1	1440	1495	8.23e-6	SMART
TSP1	1496	1551	1.23e-4	SMART
TSP1	1552	1609	2e-4	SMART
TSP1	1611	1672	1.25e-5	SMART
TSP1	1676	1730	3.47e-4	SMART
Pfam:GON	1732	1930	1.6e-85	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125490

Predicted Effect

probably benign
Transcript: ENSMUST00000167391
AA Change: V998L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: V998L

Domain	Start	End	E-Value	Type
TSP1	10	62	2.15e-9	SMART
Pfam:ADAM_spacer1	172	290	6.1e-35	PFAM
TSP1	300	355	1.14e0	SMART
Blast:TSP1	357	412	3e-28	BLAST
TSP1	419	473	3.78e-5	SMART
TSP1	474	528	5.64e-4	SMART
TSP1	529	585	1.25e-5	SMART
TSP1	605	659	1.45e-6	SMART
TSP1	661	715	4.41e-6	SMART
TSP1	747	799	7.06e-5	SMART
TSP1	800	855	4.24e-8	SMART
TSP1	859	914	8.23e-6	SMART
TSP1	915	970	1.23e-4	SMART
TSP1	971	1028	2e-4	SMART
TSP1	1030	1091	1.25e-5	SMART
TSP1	1095	1149	3.47e-4	SMART
Pfam:GON	1150	1350	2.1e-86	PFAM

Meta Mutation Damage Score

0.3268

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	T	1: 93,159,978	V51E	probably damaging	Het
Abraxas2	A	T	7: 132,859,274	I14F	probably damaging	Het
Acin1	T	C	14: 54,642,822		probably benign	Het
Adra2a	T	A	19: 54,046,608	C132S	probably damaging	Het
Aif1	T	A	17: 35,171,941		probably null	Het
Atf5	A	T	7: 44,815,086	Y27*	probably null	Het
Atm	A	G	9: 53,506,611	S799P	probably damaging	Het
Bmp2k	T	G	5: 97,087,351		probably benign	Het
Chaf1a	C	T	17: 56,065,000	H723Y	probably damaging	Het
Clint1	T	C	11: 45,907,942	W493R	probably damaging	Het
Cyb561a3	T	A	19: 10,587,866	V198D	possibly damaging	Het
Cyp2j8	T	C	4: 96,501,064	E174G	possibly damaging	Het
Cyp4v3	C	T	8: 45,306,980	G512S	probably damaging	Het
Dnah8	T	A	17: 30,700,419	V1122D	probably benign	Het
Doc2b	C	A	11: 75,786,163	G128V	probably damaging	Het
Dysf	T	C	6: 84,150,034	V1378A	probably damaging	Het
Efcab5	A	T	11: 77,137,651	S421T	possibly damaging	Het
Efcab6	T	G	15: 83,945,123	D672A	probably benign	Het
Eif2ak3	C	A	6: 70,893,129	H933Q	probably damaging	Het
Erc1	A	T	6: 119,761,159	N574K	probably damaging	Het
Eri2	A	T	7: 119,787,846		probably benign	Het
Faxc	A	G	4: 21,948,744	Y152C	probably damaging	Het
Fbxl7	T	A	15: 26,543,499	Y354F	probably damaging	Het
Fras1	T	A	5: 96,735,187	I2526N	possibly damaging	Het
Gm1966	A	G	7: 106,599,204		noncoding transcript	Het
Gm5424	A	T	10: 62,071,595		noncoding transcript	Het
Gm6728	T	C	6: 136,486,703		noncoding transcript	Het
Golgb1	A	T	16: 36,913,141	S917C	probably benign	Het
Gtpbp3	T	C	8: 71,489,418		probably benign	Het
Gusb	A	T	5: 129,999,988	Y220*	probably null	Het
Hmcn1	A	G	1: 150,595,861	V4914A	possibly damaging	Het
Iars2	C	A	1: 185,323,734	C211F	probably damaging	Het
Kif5b	A	G	18: 6,211,058	L802P	probably damaging	Het
Kif5c	A	G	2: 49,735,590	E624G	probably damaging	Het
Kmt2d	G	T	15: 98,842,860		probably benign	Het
Krt82	C	A	15: 101,548,388	G186C	possibly damaging	Het
Lca5	G	A	9: 83,423,223	R177C	probably damaging	Het
Mier1	T	C	4: 103,162,710	S318P	probably benign	Het
Obscn	A	T	11: 59,003,369	I1207N	probably damaging	Het
Olfr1161	A	C	2: 88,025,474	I251L	probably benign	Het
Olfr1261	A	G	2: 89,994,182	D263G	probably damaging	Het
Olfr1302	A	G	2: 111,781,181	Y287C	probably damaging	Het
Olfr607	A	G	7: 103,460,615	F198L	probably benign	Het
Oog4	C	T	4: 143,437,854	G369D	probably benign	Het
Plec	T	C	15: 76,176,624	T3060A	probably damaging	Het
Plekhh2	C	T	17: 84,577,165	T769I	probably damaging	Het
Prkaa1	A	T	15: 5,160,668	S65C	probably damaging	Het
Psma3	T	C	12: 70,984,642		probably benign	Het
Ptpn18	T	A	1: 34,463,510		probably benign	Het
Ptprv	T	C	1: 135,112,260		noncoding transcript	Het
Rac1	C	A	5: 143,508,131	V104L	probably benign	Het
Serpinb7	A	T	1: 107,434,749	N61I	possibly damaging	Het
Sirt7	A	C	11: 120,620,521		probably benign	Het
Srl	G	A	16: 4,482,895	R333*	probably null	Het
Srprb	A	T	9: 103,201,920	L756Q	probably damaging	Het
Tchhl1	T	C	3: 93,470,795	S269P	probably damaging	Het
Tdo2	C	T	3: 81,975,323		probably null	Het
Teddm1a	T	C	1: 153,891,900	Y37H	probably benign	Het
Tenm3	T	C	8: 48,236,855	Y1899C	probably damaging	Het
Tep1	T	C	14: 50,838,631	T1681A	probably benign	Het
Timm44	G	T	8: 4,275,919		probably null	Het
Trp73	A	G	4: 154,062,602	V322A	possibly damaging	Het
Tsr1	A	C	11: 74,905,955	E611A	probably damaging	Het
Unc80	A	G	1: 66,646,587	N2290S	possibly damaging	Het
Ush2a	T	C	1: 188,947,079	V4828A	possibly damaging	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wnt9b	C	A	11: 103,732,049	S176I	possibly damaging	Het
Zfp329	A	G	7: 12,806,526		probably benign	Het
Zfp352	T	A	4: 90,224,460	V279D	probably damaging	Het
Zfp932	C	T	5: 110,009,635	Q400*	probably null	Het
Zxdc	T	A	6: 90,382,093	L569Q	probably damaging	Het

Other mutations in Adamts9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Adamts9	APN	6	92859902	missense	possibly damaging	0.90
IGL01352:Adamts9	APN	6	92860174	missense	probably benign	0.00
IGL01462:Adamts9	APN	6	92894266	missense	probably benign	0.04
IGL01551:Adamts9	APN	6	92807020	missense	probably damaging	0.99
IGL01577:Adamts9	APN	6	92858147	splice site	probably benign
IGL01638:Adamts9	APN	6	92872428	missense	probably benign	0.19
IGL01757:Adamts9	APN	6	92796159	missense	probably damaging	1.00
IGL02102:Adamts9	APN	6	92777439	missense	probably benign	0.00
IGL02379:Adamts9	APN	6	92797033	missense	probably damaging	0.97
IGL02419:Adamts9	APN	6	92796997	missense	probably benign	0.04
IGL02554:Adamts9	APN	6	92880847	missense	probably benign	0.01
IGL02832:Adamts9	APN	6	92807175	missense	probably damaging	1.00
IGL03164:Adamts9	APN	6	92889937	missense	probably damaging	1.00
IGL03347:Adamts9	APN	6	92887432	nonsense	probably null
IGL03401:Adamts9	APN	6	92786868	missense	probably damaging	0.97
basilisk	UTSW	6	92860189	missense	probably benign	0.35
bluebeard	UTSW	6	92879959	nonsense	probably null
Serpent	UTSW	6	92908706	missense	probably damaging	1.00
PIT4402001:Adamts9	UTSW	6	92872347	missense	probably benign
PIT4458001:Adamts9	UTSW	6	92889905	missense	probably damaging	0.99
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0067:Adamts9	UTSW	6	92890167	missense	probably damaging	0.98
R0141:Adamts9	UTSW	6	92943085	missense	probably benign
R0326:Adamts9	UTSW	6	92858057	nonsense	probably null
R0396:Adamts9	UTSW	6	92798005	missense	probably benign	0.00
R0490:Adamts9	UTSW	6	92872866	missense	probably benign
R0504:Adamts9	UTSW	6	92912645	missense	probably damaging	1.00
R0620:Adamts9	UTSW	6	92858113	missense	possibly damaging	0.95
R0669:Adamts9	UTSW	6	92880957	missense	probably damaging	1.00
R0682:Adamts9	UTSW	6	92903802	missense	possibly damaging	0.80
R1412:Adamts9	UTSW	6	92796433	missense	probably benign
R1433:Adamts9	UTSW	6	92849290	critical splice donor site	probably null
R1558:Adamts9	UTSW	6	92908711	missense	possibly damaging	0.87
R1661:Adamts9	UTSW	6	92880623	missense	possibly damaging	0.92
R1801:Adamts9	UTSW	6	92863376	missense	probably benign	0.27
R1855:Adamts9	UTSW	6	92901369	splice site	probably benign
R1887:Adamts9	UTSW	6	92872788	critical splice donor site	probably null
R1934:Adamts9	UTSW	6	92943121	missense	possibly damaging	0.59
R1956:Adamts9	UTSW	6	92859849	missense	probably damaging	1.00
R1986:Adamts9	UTSW	6	92796394	missense	probably benign
R2370:Adamts9	UTSW	6	92860203	missense	probably damaging	0.99
R2376:Adamts9	UTSW	6	92912831	missense	probably benign
R2432:Adamts9	UTSW	6	92857900	missense	probably damaging	1.00
R2876:Adamts9	UTSW	6	92795910	splice site	probably benign
R3015:Adamts9	UTSW	6	92872932	missense	probably benign	0.05
R3611:Adamts9	UTSW	6	92869984	missense	probably benign	0.05
R4024:Adamts9	UTSW	6	92872784	splice site	probably benign
R4292:Adamts9	UTSW	6	92795996	missense	possibly damaging	0.95
R4403:Adamts9	UTSW	6	92859864	missense	probably damaging	1.00
R4574:Adamts9	UTSW	6	92879959	nonsense	probably null
R4677:Adamts9	UTSW	6	92816606	start codon destroyed	probably null
R5114:Adamts9	UTSW	6	92890273	missense	probably benign	0.03
R5384:Adamts9	UTSW	6	92798018	missense	probably damaging	1.00
R5423:Adamts9	UTSW	6	92880697	missense	possibly damaging	0.84
R5497:Adamts9	UTSW	6	92854365	missense	probably damaging	1.00
R5629:Adamts9	UTSW	6	92798133	missense	probably damaging	1.00
R5943:Adamts9	UTSW	6	92903786	missense	probably benign	0.02
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6051:Adamts9	UTSW	6	92859926	missense	possibly damaging	0.83
R6051:Adamts9	UTSW	6	92890118	missense	probably damaging	1.00
R6082:Adamts9	UTSW	6	92889949	missense	probably damaging	1.00
R6192:Adamts9	UTSW	6	92797021	missense	probably damaging	1.00
R6291:Adamts9	UTSW	6	92890120	missense	probably damaging	1.00
R6502:Adamts9	UTSW	6	92872335	missense	probably damaging	1.00
R6818:Adamts9	UTSW	6	92905191	missense	probably damaging	1.00
R6848:Adamts9	UTSW	6	92863354	missense	possibly damaging	0.84
R7028:Adamts9	UTSW	6	92909793	nonsense	probably null
R7095:Adamts9	UTSW	6	92887691	missense	probably benign	0.39
R7287:Adamts9	UTSW	6	92890003	missense	possibly damaging	0.89
R7294:Adamts9	UTSW	6	92894289	missense	probably damaging	1.00
R7313:Adamts9	UTSW	6	92858121	missense	probably damaging	1.00
R7581:Adamts9	UTSW	6	92937338	missense	probably benign	0.00
R7682:Adamts9	UTSW	6	92880698	missense	possibly damaging	0.57
R7691:Adamts9	UTSW	6	92796238	missense	probably damaging	1.00
R7791:Adamts9	UTSW	6	92872385	missense	probably benign	0.00
R7851:Adamts9	UTSW	6	92908706	missense	probably damaging	1.00
R7974:Adamts9	UTSW	6	92909687	critical splice donor site	probably null
R8224:Adamts9	UTSW	6	92796370	missense	probably damaging	0.96
R8328:Adamts9	UTSW	6	92890012	missense	probably benign	0.17
R8334:Adamts9	UTSW	6	92937244	splice site	probably null
R8559:Adamts9	UTSW	6	92807136	missense	probably benign	0.01
R8709:Adamts9	UTSW	6	92807163	missense	probably damaging	1.00
R8735:Adamts9	UTSW	6	92860067	intron	probably benign
R8739:Adamts9	UTSW	6	92854280	missense	probably benign	0.04
R9108:Adamts9	UTSW	6	92880740	missense	probably damaging	1.00
R9171:Adamts9	UTSW	6	92872400	missense	probably benign	0.03
R9198:Adamts9	UTSW	6	92860189	missense	probably benign	0.35
R9299:Adamts9	UTSW	6	92796995	missense	probably benign	0.00
R9300:Adamts9	UTSW	6	92887390	missense	probably benign	0.10
R9308:Adamts9	UTSW	6	92880894	missense	probably benign	0.03
R9325:Adamts9	UTSW	6	92872298	missense	probably benign	0.00
R9397:Adamts9	UTSW	6	92901463	missense	probably damaging	1.00
R9550:Adamts9	UTSW	6	92901448	missense	probably benign	0.00
R9623:Adamts9	UTSW	6	92880680	missense	probably benign	0.02
R9698:Adamts9	UTSW	6	92807140	missense	probably damaging	1.00
R9755:Adamts9	UTSW	6	92879941	missense	probably benign	0.15
RF013:Adamts9	UTSW	6	92943145	missense	possibly damaging	0.88
Z1177:Adamts9	UTSW	6	92854346	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTGGAAGGTAGGTTTCCTGTC -3'
(R):5'- GATAAAGTTGTCGGGCGCTGAG -3'

Sequencing Primer
(F):5'- AAGGTAGGTTTCCTGTCCCATTATTC -3'
(R):5'- CTGAGATAGAAACAGTCAACACTTAG -3'

Posted On

2016-07-06