Incidental Mutation 'R5260:Eri2'
ID 401376
Institutional Source Beutler Lab
Gene Symbol Eri2
Ensembl Gene ENSMUSG00000030929
Gene Name exoribonuclease 2
Synonyms Exod1, 4933424N09Rik
MMRRC Submission 042829-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 119383049-119393283 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 119387069 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033224] [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529] [ENSMUST00000139192] [ENSMUST00000150844]
AlphaFold Q5BKS4
Predicted Effect probably benign
Transcript: ENSMUST00000033224
Predicted Effect probably benign
Transcript: ENSMUST00000063770
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106526
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106527
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106528
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106529
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133926
Predicted Effect probably benign
Transcript: ENSMUST00000139192
SMART Domains Protein: ENSMUSP00000117940
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
Pfam:RNase_T 21 160 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150844
SMART Domains Protein: ENSMUSP00000120547
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
low complexity region 362 381 N/A INTRINSIC
Pfam:zf-GRF 592 640 1.4e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A T 7: 132,461,003 (GRCm39) I14F probably damaging Het
Acin1 T C 14: 54,880,279 (GRCm39) probably benign Het
Adamts9 C A 6: 92,784,118 (GRCm39) V1579L probably benign Het
Adra2a T A 19: 54,035,039 (GRCm39) C132S probably damaging Het
Aif1 T A 17: 35,390,917 (GRCm39) probably null Het
Atf5 A T 7: 44,464,510 (GRCm39) Y27* probably null Het
Atm A G 9: 53,417,911 (GRCm39) S799P probably damaging Het
Bmp2k T G 5: 97,235,210 (GRCm39) probably benign Het
Chaf1a C T 17: 56,372,000 (GRCm39) H723Y probably damaging Het
Clint1 T C 11: 45,798,769 (GRCm39) W493R probably damaging Het
Cyb561a3 T A 19: 10,565,230 (GRCm39) V198D possibly damaging Het
Cyp2j8 T C 4: 96,389,301 (GRCm39) E174G possibly damaging Het
Cyp4v3 C T 8: 45,760,017 (GRCm39) G512S probably damaging Het
Dnah8 T A 17: 30,919,393 (GRCm39) V1122D probably benign Het
Doc2b C A 11: 75,676,989 (GRCm39) G128V probably damaging Het
Dysf T C 6: 84,127,016 (GRCm39) V1378A probably damaging Het
Efcab5 A T 11: 77,028,477 (GRCm39) S421T possibly damaging Het
Efcab6 T G 15: 83,829,324 (GRCm39) D672A probably benign Het
Eif2ak3 C A 6: 70,870,113 (GRCm39) H933Q probably damaging Het
Erc1 A T 6: 119,738,120 (GRCm39) N574K probably damaging Het
Faxc A G 4: 21,948,744 (GRCm39) Y152C probably damaging Het
Fbxl7 T A 15: 26,543,585 (GRCm39) Y354F probably damaging Het
Fras1 T A 5: 96,883,046 (GRCm39) I2526N possibly damaging Het
Gm5424 A T 10: 61,907,374 (GRCm39) noncoding transcript Het
Gm6728 T C 6: 136,463,701 (GRCm39) noncoding transcript Het
Golgb1 A T 16: 36,733,503 (GRCm39) S917C probably benign Het
Gtpbp3 T C 8: 71,942,062 (GRCm39) probably benign Het
Gusb A T 5: 130,028,829 (GRCm39) Y220* probably null Het
Gvin3 A G 7: 106,198,411 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,471,612 (GRCm39) V4914A possibly damaging Het
Iars2 C A 1: 185,055,931 (GRCm39) C211F probably damaging Het
Kif5b A G 18: 6,211,058 (GRCm39) L802P probably damaging Het
Kif5c A G 2: 49,625,602 (GRCm39) E624G probably damaging Het
Kmt2d G T 15: 98,740,741 (GRCm39) probably benign Het
Krt82 C A 15: 101,456,823 (GRCm39) G186C possibly damaging Het
Lca5 G A 9: 83,305,276 (GRCm39) R177C probably damaging Het
Mab21l4 A T 1: 93,087,700 (GRCm39) V51E probably damaging Het
Mier1 T C 4: 103,019,907 (GRCm39) S318P probably benign Het
Obscn A T 11: 58,894,195 (GRCm39) I1207N probably damaging Het
Oog4 C T 4: 143,164,424 (GRCm39) G369D probably benign Het
Or4c126 A G 2: 89,824,526 (GRCm39) D263G probably damaging Het
Or4k52 A G 2: 111,611,526 (GRCm39) Y287C probably damaging Het
Or52d13 A G 7: 103,109,822 (GRCm39) F198L probably benign Het
Or5d35 A C 2: 87,855,818 (GRCm39) I251L probably benign Het
Plec T C 15: 76,060,824 (GRCm39) T3060A probably damaging Het
Plekhh2 C T 17: 84,884,593 (GRCm39) T769I probably damaging Het
Prkaa1 A T 15: 5,190,149 (GRCm39) S65C probably damaging Het
Psma3 T C 12: 71,031,416 (GRCm39) probably benign Het
Ptpn18 T A 1: 34,502,591 (GRCm39) probably benign Het
Ptprv T C 1: 135,039,998 (GRCm39) noncoding transcript Het
Rac1 C A 5: 143,493,886 (GRCm39) V104L probably benign Het
Serpinb7 A T 1: 107,362,479 (GRCm39) N61I possibly damaging Het
Sirt7 A C 11: 120,511,347 (GRCm39) probably benign Het
Srl G A 16: 4,300,759 (GRCm39) R333* probably null Het
Srprb A T 9: 103,079,119 (GRCm39) L756Q probably damaging Het
Tchhl1 T C 3: 93,378,102 (GRCm39) S269P probably damaging Het
Tdo2 C T 3: 81,882,630 (GRCm39) probably null Het
Teddm1a T C 1: 153,767,646 (GRCm39) Y37H probably benign Het
Tenm3 T C 8: 48,689,890 (GRCm39) Y1899C probably damaging Het
Tep1 T C 14: 51,076,088 (GRCm39) T1681A probably benign Het
Timm44 G T 8: 4,325,919 (GRCm39) probably null Het
Trp73 A G 4: 154,147,059 (GRCm39) V322A possibly damaging Het
Tsr1 A C 11: 74,796,781 (GRCm39) E611A probably damaging Het
Unc80 A G 1: 66,685,746 (GRCm39) N2290S possibly damaging Het
Ush2a T C 1: 188,679,276 (GRCm39) V4828A possibly damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnt9b C A 11: 103,622,875 (GRCm39) S176I possibly damaging Het
Zfp329 A G 7: 12,540,453 (GRCm39) probably benign Het
Zfp352 T A 4: 90,112,697 (GRCm39) V279D probably damaging Het
Zfp932 C T 5: 110,157,501 (GRCm39) Q400* probably null Het
Zxdc T A 6: 90,359,075 (GRCm39) L569Q probably damaging Het
Other mutations in Eri2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Eri2 APN 7 119,386,964 (GRCm39) missense probably benign 0.44
IGL00987:Eri2 APN 7 119,390,389 (GRCm39) missense probably damaging 1.00
IGL01139:Eri2 APN 7 119,385,960 (GRCm39) critical splice donor site probably null
IGL01476:Eri2 APN 7 119,389,472 (GRCm39) missense probably damaging 1.00
IGL02019:Eri2 APN 7 119,385,303 (GRCm39) nonsense probably null
IGL02208:Eri2 APN 7 119,385,158 (GRCm39) missense probably benign 0.00
IGL02395:Eri2 APN 7 119,387,033 (GRCm39) missense probably damaging 0.98
IGL02405:Eri2 APN 7 119,384,705 (GRCm39) missense probably damaging 1.00
IGL02646:Eri2 APN 7 119,385,331 (GRCm39) missense possibly damaging 0.87
IGL02659:Eri2 APN 7 119,386,665 (GRCm39) missense probably damaging 0.98
alien UTSW 7 119,390,397 (GRCm39) missense probably damaging 1.00
extraterrestrial UTSW 7 119,393,139 (GRCm39) critical splice donor site probably null
G5030:Eri2 UTSW 7 119,385,601 (GRCm39) missense possibly damaging 0.58
K7894:Eri2 UTSW 7 119,384,494 (GRCm39) missense probably benign 0.39
PIT4434001:Eri2 UTSW 7 119,385,524 (GRCm39) missense probably benign 0.00
R0152:Eri2 UTSW 7 119,389,606 (GRCm39) missense probably damaging 1.00
R0378:Eri2 UTSW 7 119,393,139 (GRCm39) critical splice donor site probably null
R0532:Eri2 UTSW 7 119,385,206 (GRCm39) missense probably benign 0.22
R0630:Eri2 UTSW 7 119,385,640 (GRCm39) missense probably benign 0.27
R1192:Eri2 UTSW 7 119,391,540 (GRCm39) missense probably damaging 1.00
R1416:Eri2 UTSW 7 119,390,397 (GRCm39) missense probably damaging 1.00
R1884:Eri2 UTSW 7 119,390,346 (GRCm39) missense probably benign 0.12
R2173:Eri2 UTSW 7 119,385,766 (GRCm39) missense possibly damaging 0.67
R2961:Eri2 UTSW 7 119,384,567 (GRCm39) missense probably benign
R3805:Eri2 UTSW 7 119,385,231 (GRCm39) nonsense probably null
R3807:Eri2 UTSW 7 119,385,231 (GRCm39) nonsense probably null
R4534:Eri2 UTSW 7 119,389,466 (GRCm39) missense probably damaging 1.00
R4738:Eri2 UTSW 7 119,386,955 (GRCm39) critical splice donor site probably null
R4776:Eri2 UTSW 7 119,384,169 (GRCm39) utr 3 prime probably benign
R4780:Eri2 UTSW 7 119,384,903 (GRCm39) missense probably benign 0.43
R5037:Eri2 UTSW 7 119,384,897 (GRCm39) missense probably benign
R5315:Eri2 UTSW 7 119,385,241 (GRCm39) missense probably benign 0.00
R5884:Eri2 UTSW 7 119,371,552 (GRCm39) makesense probably null
R5927:Eri2 UTSW 7 119,385,291 (GRCm39) missense probably damaging 1.00
R6937:Eri2 UTSW 7 119,386,012 (GRCm39) missense probably damaging 0.96
R7296:Eri2 UTSW 7 119,385,739 (GRCm39) nonsense probably null
R7302:Eri2 UTSW 7 119,386,009 (GRCm39) missense probably benign 0.38
R7480:Eri2 UTSW 7 119,385,734 (GRCm39) nonsense probably null
R7494:Eri2 UTSW 7 119,385,304 (GRCm39) missense probably damaging 0.99
R7524:Eri2 UTSW 7 119,384,972 (GRCm39) missense probably benign 0.00
R8187:Eri2 UTSW 7 119,384,767 (GRCm39) missense probably damaging 1.00
R8373:Eri2 UTSW 7 119,371,820 (GRCm39) missense probably benign 0.02
R8551:Eri2 UTSW 7 119,387,062 (GRCm39) splice site probably null
R9710:Eri2 UTSW 7 119,384,824 (GRCm39) missense probably benign
R9720:Eri2 UTSW 7 119,386,976 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTTATTACTGCTGTGCTGTCTC -3'
(R):5'- CCCAGAAGATAGCATTTTGAAACAG -3'

Sequencing Primer
(F):5'- GCTGTGCTGTCTCAAATATTTTAAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2016-07-06