Incidental Mutation 'R5260:Eri2'
ID 401376
Institutional Source Beutler Lab
Gene Symbol Eri2
Ensembl Gene ENSMUSG00000030929
Gene Name exoribonuclease 2
Synonyms 4933424N09Rik, Exod1
MMRRC Submission 042829-MU
Accession Numbers

Genbank: NM_027698

Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 119768679-119794058 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 119787846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033224] [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529] [ENSMUST00000139192] [ENSMUST00000150844]
AlphaFold Q5BKS4
Predicted Effect probably benign
Transcript: ENSMUST00000033224
Predicted Effect probably benign
Transcript: ENSMUST00000063770
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106526
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106527
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106528
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106529
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133926
Predicted Effect probably benign
Transcript: ENSMUST00000139192
SMART Domains Protein: ENSMUSP00000117940
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
Pfam:RNase_T 21 160 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150844
SMART Domains Protein: ENSMUSP00000120547
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
low complexity region 362 381 N/A INTRINSIC
Pfam:zf-GRF 592 640 1.4e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Eri2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Eri2 APN 7 119787741 missense probably benign 0.44
IGL00987:Eri2 APN 7 119791166 missense probably damaging 1.00
IGL01139:Eri2 APN 7 119786737 critical splice donor site probably null
IGL01476:Eri2 APN 7 119790249 missense probably damaging 1.00
IGL02019:Eri2 APN 7 119786080 nonsense probably null
IGL02208:Eri2 APN 7 119785935 missense probably benign 0.00
IGL02395:Eri2 APN 7 119787810 missense probably damaging 0.98
IGL02405:Eri2 APN 7 119785482 missense probably damaging 1.00
IGL02646:Eri2 APN 7 119786108 missense possibly damaging 0.87
IGL02659:Eri2 APN 7 119787442 missense probably damaging 0.98
alien UTSW 7 119791174 missense probably damaging 1.00
extraterrestrial UTSW 7 119793916 critical splice donor site probably null
G5030:Eri2 UTSW 7 119786378 missense possibly damaging 0.58
K7894:Eri2 UTSW 7 119785271 missense probably benign 0.39
PIT4434001:Eri2 UTSW 7 119786301 missense probably benign 0.00
R0152:Eri2 UTSW 7 119790383 missense probably damaging 1.00
R0378:Eri2 UTSW 7 119793916 critical splice donor site probably null
R0532:Eri2 UTSW 7 119785983 missense probably benign 0.22
R0630:Eri2 UTSW 7 119786417 missense probably benign 0.27
R1192:Eri2 UTSW 7 119792317 missense probably damaging 1.00
R1416:Eri2 UTSW 7 119791174 missense probably damaging 1.00
R1884:Eri2 UTSW 7 119791123 missense probably benign 0.12
R2173:Eri2 UTSW 7 119786543 missense possibly damaging 0.67
R2961:Eri2 UTSW 7 119785344 missense probably benign
R3805:Eri2 UTSW 7 119786008 nonsense probably null
R3807:Eri2 UTSW 7 119786008 nonsense probably null
R4534:Eri2 UTSW 7 119790243 missense probably damaging 1.00
R4738:Eri2 UTSW 7 119787732 critical splice donor site probably null
R4776:Eri2 UTSW 7 119784946 utr 3 prime probably benign
R4780:Eri2 UTSW 7 119785680 missense probably benign 0.43
R5037:Eri2 UTSW 7 119785674 missense probably benign
R5315:Eri2 UTSW 7 119786018 missense probably benign 0.00
R5884:Eri2 UTSW 7 119772329 makesense probably null
R5927:Eri2 UTSW 7 119786068 missense probably damaging 1.00
R6937:Eri2 UTSW 7 119786789 missense probably damaging 0.96
R7296:Eri2 UTSW 7 119786516 nonsense probably null
R7302:Eri2 UTSW 7 119786786 missense probably benign 0.38
R7480:Eri2 UTSW 7 119786511 nonsense probably null
R7494:Eri2 UTSW 7 119786081 missense probably damaging 0.99
R7524:Eri2 UTSW 7 119785749 missense probably benign 0.00
R8187:Eri2 UTSW 7 119785544 missense probably damaging 1.00
R8373:Eri2 UTSW 7 119772597 missense probably benign 0.02
R8551:Eri2 UTSW 7 119787839 splice site probably null
R9710:Eri2 UTSW 7 119785601 missense probably benign
R9720:Eri2 UTSW 7 119787753 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTTATTACTGCTGTGCTGTCTC -3'
(R):5'- CCCAGAAGATAGCATTTTGAAACAG -3'

Sequencing Primer
(F):5'- GCTGTGCTGTCTCAAATATTTTAAG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2016-07-06