Incidental Mutation 'R5260:Gtpbp3'
ID 401380
Institutional Source Beutler Lab
Gene Symbol Gtpbp3
Ensembl Gene ENSMUSG00000007610
Gene Name GTP binding protein 3
Synonyms 2410009F13Rik, Gtpbp3
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71488103-71499583 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 71489418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007754] [ENSMUST00000093450] [ENSMUST00000095259] [ENSMUST00000127741] [ENSMUST00000150969] [ENSMUST00000168847] [ENSMUST00000213382]
AlphaFold Q923K4
Predicted Effect probably benign
Transcript: ENSMUST00000007754
SMART Domains Protein: ENSMUSP00000007754
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093450
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095259
SMART Domains Protein: ENSMUSP00000092892
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124349
Predicted Effect probably benign
Transcript: ENSMUST00000127741
SMART Domains Protein: ENSMUSP00000123082
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 2.2e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146551
Predicted Effect probably benign
Transcript: ENSMUST00000150969
SMART Domains Protein: ENSMUSP00000114193
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168847
SMART Domains Protein: ENSMUSP00000126761
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 153 3e-35 PFAM
Pfam:MnmE_helical 156 490 2e-48 PFAM
Pfam:FeoB_N 251 390 1.5e-7 PFAM
Pfam:MMR_HSR1 252 376 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213382
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a GTP-binding protein. The encoded protein is localized to the mitochondria and may play a role in mitochondrial tRNA modification. Polymorphisms at this locus may be associated with severity of aminoglycoside-induced deafness, a disease associated with a mutation in the 12S rRNA. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Gtpbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Gtpbp3 APN 8 71490434 missense probably damaging 1.00
IGL02476:Gtpbp3 APN 8 71492598 missense probably damaging 1.00
IGL02669:Gtpbp3 APN 8 71490902 missense probably damaging 1.00
IGL02885:Gtpbp3 APN 8 71489420 unclassified probably benign
IGL03038:Gtpbp3 APN 8 71489303 missense possibly damaging 0.94
R0267:Gtpbp3 UTSW 8 71491497 missense probably damaging 1.00
R0442:Gtpbp3 UTSW 8 71491491 missense probably damaging 0.97
R0639:Gtpbp3 UTSW 8 71492735 missense probably damaging 1.00
R0673:Gtpbp3 UTSW 8 71492735 missense probably damaging 1.00
R1844:Gtpbp3 UTSW 8 71492628 missense probably benign 0.05
R1957:Gtpbp3 UTSW 8 71490455 missense probably damaging 1.00
R2996:Gtpbp3 UTSW 8 71489496 missense possibly damaging 0.69
R3703:Gtpbp3 UTSW 8 71492135 missense probably benign 0.00
R3705:Gtpbp3 UTSW 8 71492135 missense probably benign 0.00
R4084:Gtpbp3 UTSW 8 71490512 missense probably benign 0.00
R4181:Gtpbp3 UTSW 8 71491467 missense probably damaging 1.00
R4705:Gtpbp3 UTSW 8 71491114 missense probably benign 0.23
R5081:Gtpbp3 UTSW 8 71490382 missense probably damaging 1.00
R5619:Gtpbp3 UTSW 8 71491048 intron probably benign
R5844:Gtpbp3 UTSW 8 71492555 missense probably benign 0.01
R6666:Gtpbp3 UTSW 8 71490938 missense possibly damaging 0.61
R7092:Gtpbp3 UTSW 8 71492265 missense probably benign
R7295:Gtpbp3 UTSW 8 71489495 missense possibly damaging 0.81
R7532:Gtpbp3 UTSW 8 71489463 missense probably benign 0.00
R7657:Gtpbp3 UTSW 8 71491121 missense probably benign
R7948:Gtpbp3 UTSW 8 71492586 missense probably damaging 1.00
R8094:Gtpbp3 UTSW 8 71488836 missense possibly damaging 0.52
R8138:Gtpbp3 UTSW 8 71492598 missense probably damaging 1.00
R8935:Gtpbp3 UTSW 8 71492537 critical splice acceptor site probably null
R8973:Gtpbp3 UTSW 8 71491162 missense possibly damaging 0.82
R9087:Gtpbp3 UTSW 8 71492355 missense probably benign 0.27
X0013:Gtpbp3 UTSW 8 71492693 missense possibly damaging 0.77
X0021:Gtpbp3 UTSW 8 71490517 splice site probably null
Z1177:Gtpbp3 UTSW 8 71489069 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCACCATCTTCGCACTCAG -3'
(R):5'- CCCAAATGACAATGTGTTTTGC -3'

Sequencing Primer
(F):5'- TTCGCACTCAGCTCCGG -3'
(R):5'- GACAATGTGTTTTGCAGTCTATCTC -3'
Posted On 2016-07-06