Incidental Mutation 'R5260:Efcab5'
ID 401392
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene Name EF-hand calcium binding domain 5
Synonyms 4930563A03Rik
MMRRC Submission 042829-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 76980741-77079794 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 77028477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 421 (S421T)
Ref Sequence ENSEMBL: ENSMUSP00000104037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
AlphaFold A0JP43
Predicted Effect possibly damaging
Transcript: ENSMUST00000108400
AA Change: S421T

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: S421T

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130901
AA Change: S285T

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944
AA Change: S285T

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148985
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A T 7: 132,461,003 (GRCm39) I14F probably damaging Het
Acin1 T C 14: 54,880,279 (GRCm39) probably benign Het
Adamts9 C A 6: 92,784,118 (GRCm39) V1579L probably benign Het
Adra2a T A 19: 54,035,039 (GRCm39) C132S probably damaging Het
Aif1 T A 17: 35,390,917 (GRCm39) probably null Het
Atf5 A T 7: 44,464,510 (GRCm39) Y27* probably null Het
Atm A G 9: 53,417,911 (GRCm39) S799P probably damaging Het
Bmp2k T G 5: 97,235,210 (GRCm39) probably benign Het
Chaf1a C T 17: 56,372,000 (GRCm39) H723Y probably damaging Het
Clint1 T C 11: 45,798,769 (GRCm39) W493R probably damaging Het
Cyb561a3 T A 19: 10,565,230 (GRCm39) V198D possibly damaging Het
Cyp2j8 T C 4: 96,389,301 (GRCm39) E174G possibly damaging Het
Cyp4v3 C T 8: 45,760,017 (GRCm39) G512S probably damaging Het
Dnah8 T A 17: 30,919,393 (GRCm39) V1122D probably benign Het
Doc2b C A 11: 75,676,989 (GRCm39) G128V probably damaging Het
Dysf T C 6: 84,127,016 (GRCm39) V1378A probably damaging Het
Efcab6 T G 15: 83,829,324 (GRCm39) D672A probably benign Het
Eif2ak3 C A 6: 70,870,113 (GRCm39) H933Q probably damaging Het
Erc1 A T 6: 119,738,120 (GRCm39) N574K probably damaging Het
Eri2 A T 7: 119,387,069 (GRCm39) probably benign Het
Faxc A G 4: 21,948,744 (GRCm39) Y152C probably damaging Het
Fbxl7 T A 15: 26,543,585 (GRCm39) Y354F probably damaging Het
Fras1 T A 5: 96,883,046 (GRCm39) I2526N possibly damaging Het
Gm5424 A T 10: 61,907,374 (GRCm39) noncoding transcript Het
Gm6728 T C 6: 136,463,701 (GRCm39) noncoding transcript Het
Golgb1 A T 16: 36,733,503 (GRCm39) S917C probably benign Het
Gtpbp3 T C 8: 71,942,062 (GRCm39) probably benign Het
Gusb A T 5: 130,028,829 (GRCm39) Y220* probably null Het
Gvin3 A G 7: 106,198,411 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,471,612 (GRCm39) V4914A possibly damaging Het
Iars2 C A 1: 185,055,931 (GRCm39) C211F probably damaging Het
Kif5b A G 18: 6,211,058 (GRCm39) L802P probably damaging Het
Kif5c A G 2: 49,625,602 (GRCm39) E624G probably damaging Het
Kmt2d G T 15: 98,740,741 (GRCm39) probably benign Het
Krt82 C A 15: 101,456,823 (GRCm39) G186C possibly damaging Het
Lca5 G A 9: 83,305,276 (GRCm39) R177C probably damaging Het
Mab21l4 A T 1: 93,087,700 (GRCm39) V51E probably damaging Het
Mier1 T C 4: 103,019,907 (GRCm39) S318P probably benign Het
Obscn A T 11: 58,894,195 (GRCm39) I1207N probably damaging Het
Oog4 C T 4: 143,164,424 (GRCm39) G369D probably benign Het
Or4c126 A G 2: 89,824,526 (GRCm39) D263G probably damaging Het
Or4k52 A G 2: 111,611,526 (GRCm39) Y287C probably damaging Het
Or52d13 A G 7: 103,109,822 (GRCm39) F198L probably benign Het
Or5d35 A C 2: 87,855,818 (GRCm39) I251L probably benign Het
Plec T C 15: 76,060,824 (GRCm39) T3060A probably damaging Het
Plekhh2 C T 17: 84,884,593 (GRCm39) T769I probably damaging Het
Prkaa1 A T 15: 5,190,149 (GRCm39) S65C probably damaging Het
Psma3 T C 12: 71,031,416 (GRCm39) probably benign Het
Ptpn18 T A 1: 34,502,591 (GRCm39) probably benign Het
Ptprv T C 1: 135,039,998 (GRCm39) noncoding transcript Het
Rac1 C A 5: 143,493,886 (GRCm39) V104L probably benign Het
Serpinb7 A T 1: 107,362,479 (GRCm39) N61I possibly damaging Het
Sirt7 A C 11: 120,511,347 (GRCm39) probably benign Het
Srl G A 16: 4,300,759 (GRCm39) R333* probably null Het
Srprb A T 9: 103,079,119 (GRCm39) L756Q probably damaging Het
Tchhl1 T C 3: 93,378,102 (GRCm39) S269P probably damaging Het
Tdo2 C T 3: 81,882,630 (GRCm39) probably null Het
Teddm1a T C 1: 153,767,646 (GRCm39) Y37H probably benign Het
Tenm3 T C 8: 48,689,890 (GRCm39) Y1899C probably damaging Het
Tep1 T C 14: 51,076,088 (GRCm39) T1681A probably benign Het
Timm44 G T 8: 4,325,919 (GRCm39) probably null Het
Trp73 A G 4: 154,147,059 (GRCm39) V322A possibly damaging Het
Tsr1 A C 11: 74,796,781 (GRCm39) E611A probably damaging Het
Unc80 A G 1: 66,685,746 (GRCm39) N2290S possibly damaging Het
Ush2a T C 1: 188,679,276 (GRCm39) V4828A possibly damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnt9b C A 11: 103,622,875 (GRCm39) S176I possibly damaging Het
Zfp329 A G 7: 12,540,453 (GRCm39) probably benign Het
Zfp352 T A 4: 90,112,697 (GRCm39) V279D probably damaging Het
Zfp932 C T 5: 110,157,501 (GRCm39) Q400* probably null Het
Zxdc T A 6: 90,359,075 (GRCm39) L569Q probably damaging Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77,027,862 (GRCm39) missense probably benign 0.04
IGL01343:Efcab5 APN 11 77,020,756 (GRCm39) missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77,012,140 (GRCm39) missense probably benign 0.38
IGL02270:Efcab5 APN 11 76,995,139 (GRCm39) missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77,028,714 (GRCm39) nonsense probably null
IGL02653:Efcab5 APN 11 77,022,848 (GRCm39) missense probably damaging 0.99
IGL02818:Efcab5 APN 11 76,996,174 (GRCm39) missense probably damaging 0.99
IGL03068:Efcab5 APN 11 76,994,927 (GRCm39) missense probably benign
IGL03222:Efcab5 APN 11 77,028,193 (GRCm39) missense probably benign 0.40
IGL03226:Efcab5 APN 11 77,028,501 (GRCm39) missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77,079,596 (GRCm39) missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77,028,517 (GRCm39)
PIT4418001:Efcab5 UTSW 11 77,022,877 (GRCm39) missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77,031,749 (GRCm39) missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77,020,702 (GRCm39) missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77,031,749 (GRCm39) missense probably damaging 1.00
R0284:Efcab5 UTSW 11 76,994,353 (GRCm39) intron probably benign
R0386:Efcab5 UTSW 11 77,063,204 (GRCm39) missense probably benign 0.30
R0386:Efcab5 UTSW 11 77,031,749 (GRCm39) missense probably damaging 1.00
R0966:Efcab5 UTSW 11 77,031,749 (GRCm39) missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77,031,749 (GRCm39) missense probably damaging 1.00
R1433:Efcab5 UTSW 11 76,996,204 (GRCm39) missense probably benign 0.09
R1673:Efcab5 UTSW 11 77,042,679 (GRCm39) missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77,025,701 (GRCm39) missense probably benign 0.00
R1848:Efcab5 UTSW 11 76,994,132 (GRCm39) missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77,063,147 (GRCm39) missense probably benign 0.06
R3713:Efcab5 UTSW 11 77,007,008 (GRCm39) missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77,008,656 (GRCm39) missense probably damaging 0.98
R4020:Efcab5 UTSW 11 76,994,930 (GRCm39) missense probably benign 0.33
R4391:Efcab5 UTSW 11 76,981,284 (GRCm39) missense probably damaging 0.99
R4392:Efcab5 UTSW 11 76,981,284 (GRCm39) missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77,004,507 (GRCm39) missense probably damaging 1.00
R4929:Efcab5 UTSW 11 76,994,209 (GRCm39) missense probably benign 0.36
R4985:Efcab5 UTSW 11 77,029,055 (GRCm39) missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77,028,078 (GRCm39) missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77,079,671 (GRCm39) missense probably damaging 1.00
R5387:Efcab5 UTSW 11 77,025,668 (GRCm39) missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77,079,615 (GRCm39) missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77,042,747 (GRCm39) missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77,079,701 (GRCm39) missense probably benign 0.09
R5922:Efcab5 UTSW 11 77,079,570 (GRCm39) missense probably benign 0.44
R6030:Efcab5 UTSW 11 77,012,088 (GRCm39) missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77,012,088 (GRCm39) missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77,028,084 (GRCm39) missense probably benign 0.04
R6437:Efcab5 UTSW 11 77,028,728 (GRCm39) missense probably benign 0.25
R6442:Efcab5 UTSW 11 76,996,260 (GRCm39) nonsense probably null
R6592:Efcab5 UTSW 11 77,004,436 (GRCm39) missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 76,996,258 (GRCm39) missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77,028,605 (GRCm39) missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77,029,041 (GRCm39) missense possibly damaging 0.49
R7285:Efcab5 UTSW 11 77,028,170 (GRCm39) missense probably benign
R7350:Efcab5 UTSW 11 77,028,387 (GRCm39) missense probably benign 0.05
R7369:Efcab5 UTSW 11 77,008,661 (GRCm39) missense possibly damaging 0.60
R7760:Efcab5 UTSW 11 77,042,752 (GRCm39) missense probably benign 0.31
R8213:Efcab5 UTSW 11 77,006,897 (GRCm39) missense probably damaging 1.00
R8690:Efcab5 UTSW 11 76,994,115 (GRCm39) missense probably damaging 0.98
R9294:Efcab5 UTSW 11 77,012,064 (GRCm39) missense probably benign 0.03
R9310:Efcab5 UTSW 11 77,004,531 (GRCm39) missense probably benign 0.23
R9324:Efcab5 UTSW 11 77,004,546 (GRCm39) missense possibly damaging 0.95
R9404:Efcab5 UTSW 11 77,022,934 (GRCm39) missense probably damaging 0.99
R9405:Efcab5 UTSW 11 77,022,934 (GRCm39) missense probably damaging 0.99
R9407:Efcab5 UTSW 11 77,022,934 (GRCm39) missense probably damaging 0.99
R9509:Efcab5 UTSW 11 76,994,977 (GRCm39) missense possibly damaging 0.94
R9562:Efcab5 UTSW 11 77,022,934 (GRCm39) missense probably damaging 0.99
R9651:Efcab5 UTSW 11 77,022,934 (GRCm39) missense probably damaging 0.99
R9748:Efcab5 UTSW 11 77,007,022 (GRCm39) nonsense probably null
X0061:Efcab5 UTSW 11 77,007,060 (GRCm39) missense probably damaging 1.00
Z1176:Efcab5 UTSW 11 77,022,965 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GACGACTTTCTGCGTTGTCC -3'
(R):5'- GTCCCGAAGAAGCTCTACAG -3'

Sequencing Primer
(F):5'- GCCCAGGTTCTGAAATTGACC -3'
(R):5'- GCTCTACAGTAGAACAAACTCGG -3'
Posted On 2016-07-06