Incidental Mutation 'R5260:Wnt9b'
ID401393
Institutional Source Beutler Lab
Gene Symbol Wnt9b
Ensembl Gene ENSMUSG00000018486
Gene Namewingless-type MMTV integration site family, member 9B
SynonymsWnt15, Wnt14b, clf, clf1
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5260 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103727364-103749821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 103732049 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 176 (S176I)
Ref Sequence ENSEMBL: ENSMUSP00000018630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018630
AA Change: S176I

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018630
Gene: ENSMUSG00000018486
AA Change: S176I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 44 52 N/A INTRINSIC
WNT1 58 358 5.38e-98 SMART
Meta Mutation Damage Score 0.1938 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. Study of its expression in the teratocarcinoma cell line NT2 suggests that it may be implicated in the early process of neuronal differentiation of NT2 cells induced by retinoic acid. This gene is clustered with WNT3, another family member, in the chromosome 17q21 region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice display neonatal lethality, disrupted ureteric bud branching, impaired Mullerian duct formation, and incompletely penetrant cleft lip and palate. In mice with alleles that decrease expression kidneys are smaller with fewer mature nephrons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Wnt9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Wnt9b APN 11 103732010 missense probably damaging 1.00
IGL01517:Wnt9b APN 11 103731081 missense probably benign 0.13
IGL02348:Wnt9b APN 11 103732082 missense probably damaging 1.00
market UTSW 11 103731228 splice site probably null
R1711:Wnt9b UTSW 11 103732128 missense probably damaging 1.00
R1956:Wnt9b UTSW 11 103730812 missense probably damaging 1.00
R4044:Wnt9b UTSW 11 103731998 missense probably damaging 1.00
R4572:Wnt9b UTSW 11 103732155 missense probably damaging 1.00
R4619:Wnt9b UTSW 11 103731123 missense probably benign 0.13
R5239:Wnt9b UTSW 11 103731228 splice site probably null
R6962:Wnt9b UTSW 11 103733689 missense probably null 0.76
R7428:Wnt9b UTSW 11 103730817 missense probably benign 0.05
R8186:Wnt9b UTSW 11 103730775 missense probably damaging 0.99
R8693:Wnt9b UTSW 11 103733661 missense probably damaging 0.98
Z1177:Wnt9b UTSW 11 103732037 missense probably damaging 1.00
Z1177:Wnt9b UTSW 11 103733650 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACGCAGAGAAGGTTCACAAC -3'
(R):5'- GCACAGGCTTTAAGGAGACG -3'

Sequencing Primer
(F):5'- TCACAACGGGGTCTGAAGTTCATC -3'
(R):5'- CTTTAAGGAGACGGCCTTCCTG -3'
Posted On2016-07-06