Mutagenetix > Incidental Mutation

Incidental Mutation 'R5260:Tep1'

401396

Institutional Source

Beutler Lab

Gene Symbol

Tep1

Ensembl Gene

ENSMUSG00000006281

Gene Name

telomerase associated protein 1

Synonyms

Tp1

MMRRC Submission

042829-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5260 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

50824059-50870560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50838631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1681 (T1681A)

Ref Sequence

ENSEMBL: ENSMUSP00000006444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006444]

AlphaFold

P97499

Predicted Effect

probably benign
Transcript: ENSMUST00000006444
AA Change: T1681A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: T1681A

Domain	Start	End	E-Value	Type
Pfam:TEP1_N	1	29	2.8e-20	PFAM
Pfam:TEP1_N	31	59	1.4e-20	PFAM
Pfam:TEP1_N	61	89	3.1e-20	PFAM
Pfam:TEP1_N	91	119	3e-20	PFAM
low complexity region	195	207	N/A	INTRINSIC
low complexity region	211	229	N/A	INTRINSIC
Pfam:TROVE	230	685	3.2e-136	PFAM
Pfam:DUF4062	909	1020	2.4e-22	PFAM
Pfam:NACHT	1171	1346	9.2e-38	PFAM
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1622	1641	N/A	INTRINSIC
WD40	1673	1711	2.98e-1	SMART
WD40	1714	1752	5.33e0	SMART
WD40	1755	1794	1.52e-4	SMART
WD40	1797	1835	3.27e-4	SMART
WD40	1838	1877	3.09e-1	SMART
WD40	1880	1919	2.24e-2	SMART
WD40	1925	1962	4.95e0	SMART
WD40	1968	2003	2.29e1	SMART
WD40	2008	2045	1.72e0	SMART
WD40	2058	2097	3.89e-11	SMART
WD40	2103	2142	3.93e-7	SMART
WD40	2145	2182	4.38e-5	SMART
WD40	2184	2232	1.24e0	SMART
WD40	2235	2273	1.14e-3	SMART
WD40	2275	2315	4.46e-1	SMART
Blast:WD40	2316	2353	4e-12	BLAST
WD40	2546	2583	6.79e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226430

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227193

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227228

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	T	1: 93,159,978	V51E	probably damaging	Het
Abraxas2	A	T	7: 132,859,274	I14F	probably damaging	Het
Acin1	T	C	14: 54,642,822		probably benign	Het
Adamts9	C	A	6: 92,807,137	V1579L	probably benign	Het
Adra2a	T	A	19: 54,046,608	C132S	probably damaging	Het
Aif1	T	A	17: 35,171,941		probably null	Het
Atf5	A	T	7: 44,815,086	Y27*	probably null	Het
Atm	A	G	9: 53,506,611	S799P	probably damaging	Het
Bmp2k	T	G	5: 97,087,351		probably benign	Het
Chaf1a	C	T	17: 56,065,000	H723Y	probably damaging	Het
Clint1	T	C	11: 45,907,942	W493R	probably damaging	Het
Cyb561a3	T	A	19: 10,587,866	V198D	possibly damaging	Het
Cyp2j8	T	C	4: 96,501,064	E174G	possibly damaging	Het
Cyp4v3	C	T	8: 45,306,980	G512S	probably damaging	Het
Dnah8	T	A	17: 30,700,419	V1122D	probably benign	Het
Doc2b	C	A	11: 75,786,163	G128V	probably damaging	Het
Dysf	T	C	6: 84,150,034	V1378A	probably damaging	Het
Efcab5	A	T	11: 77,137,651	S421T	possibly damaging	Het
Efcab6	T	G	15: 83,945,123	D672A	probably benign	Het
Eif2ak3	C	A	6: 70,893,129	H933Q	probably damaging	Het
Erc1	A	T	6: 119,761,159	N574K	probably damaging	Het
Eri2	A	T	7: 119,787,846		probably benign	Het
Faxc	A	G	4: 21,948,744	Y152C	probably damaging	Het
Fbxl7	T	A	15: 26,543,499	Y354F	probably damaging	Het
Fras1	T	A	5: 96,735,187	I2526N	possibly damaging	Het
Gm1966	A	G	7: 106,599,204		noncoding transcript	Het
Gm5424	A	T	10: 62,071,595		noncoding transcript	Het
Gm6728	T	C	6: 136,486,703		noncoding transcript	Het
Golgb1	A	T	16: 36,913,141	S917C	probably benign	Het
Gtpbp3	T	C	8: 71,489,418		probably benign	Het
Gusb	A	T	5: 129,999,988	Y220*	probably null	Het
Hmcn1	A	G	1: 150,595,861	V4914A	possibly damaging	Het
Iars2	C	A	1: 185,323,734	C211F	probably damaging	Het
Kif5b	A	G	18: 6,211,058	L802P	probably damaging	Het
Kif5c	A	G	2: 49,735,590	E624G	probably damaging	Het
Kmt2d	G	T	15: 98,842,860		probably benign	Het
Krt82	C	A	15: 101,548,388	G186C	possibly damaging	Het
Lca5	G	A	9: 83,423,223	R177C	probably damaging	Het
Mier1	T	C	4: 103,162,710	S318P	probably benign	Het
Obscn	A	T	11: 59,003,369	I1207N	probably damaging	Het
Olfr1161	A	C	2: 88,025,474	I251L	probably benign	Het
Olfr1261	A	G	2: 89,994,182	D263G	probably damaging	Het
Olfr1302	A	G	2: 111,781,181	Y287C	probably damaging	Het
Olfr607	A	G	7: 103,460,615	F198L	probably benign	Het
Oog4	C	T	4: 143,437,854	G369D	probably benign	Het
Plec	T	C	15: 76,176,624	T3060A	probably damaging	Het
Plekhh2	C	T	17: 84,577,165	T769I	probably damaging	Het
Prkaa1	A	T	15: 5,160,668	S65C	probably damaging	Het
Psma3	T	C	12: 70,984,642		probably benign	Het
Ptpn18	T	A	1: 34,463,510		probably benign	Het
Ptprv	T	C	1: 135,112,260		noncoding transcript	Het
Rac1	C	A	5: 143,508,131	V104L	probably benign	Het
Serpinb7	A	T	1: 107,434,749	N61I	possibly damaging	Het
Sirt7	A	C	11: 120,620,521		probably benign	Het
Srl	G	A	16: 4,482,895	R333*	probably null	Het
Srprb	A	T	9: 103,201,920	L756Q	probably damaging	Het
Tchhl1	T	C	3: 93,470,795	S269P	probably damaging	Het
Tdo2	C	T	3: 81,975,323		probably null	Het
Teddm1a	T	C	1: 153,891,900	Y37H	probably benign	Het
Tenm3	T	C	8: 48,236,855	Y1899C	probably damaging	Het
Timm44	G	T	8: 4,275,919		probably null	Het
Trp73	A	G	4: 154,062,602	V322A	possibly damaging	Het
Tsr1	A	C	11: 74,905,955	E611A	probably damaging	Het
Unc80	A	G	1: 66,646,587	N2290S	possibly damaging	Het
Ush2a	T	C	1: 188,947,079	V4828A	possibly damaging	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wnt9b	C	A	11: 103,732,049	S176I	possibly damaging	Het
Zfp329	A	G	7: 12,806,526		probably benign	Het
Zfp352	T	A	4: 90,224,460	V279D	probably damaging	Het
Zfp932	C	T	5: 110,009,635	Q400*	probably null	Het
Zxdc	T	A	6: 90,382,093	L569Q	probably damaging	Het

Other mutations in Tep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Tep1	APN	14	50843184	missense	probably damaging	1.00
IGL00490:Tep1	APN	14	50833473	missense	probably damaging	0.97
IGL01114:Tep1	APN	14	50850639	missense	probably damaging	0.98
IGL01294:Tep1	APN	14	50829657	splice site	probably benign
IGL01902:Tep1	APN	14	50866091	splice site	probably benign
IGL01910:Tep1	APN	14	50844112	missense	probably benign	0.06
IGL01925:Tep1	APN	14	50824498	unclassified	probably benign
IGL01965:Tep1	APN	14	50863495	splice site	probably benign
IGL02071:Tep1	APN	14	50834049	missense	possibly damaging	0.93
IGL02124:Tep1	APN	14	50854124	unclassified	probably benign
IGL02189:Tep1	APN	14	50826826	missense	probably benign
IGL02252:Tep1	APN	14	50830255	missense	possibly damaging	0.93
IGL02299:Tep1	APN	14	50840671	missense	probably damaging	0.99
IGL02343:Tep1	APN	14	50829247	missense	probably damaging	0.99
IGL02423:Tep1	APN	14	50844620	missense	possibly damaging	0.53
IGL02537:Tep1	APN	14	50836113	missense	probably damaging	0.96
IGL02601:Tep1	APN	14	50833478	nonsense	probably null
IGL02941:Tep1	APN	14	50866037	missense	probably damaging	0.98
IGL02990:Tep1	APN	14	50868246	missense	possibly damaging	0.86
IGL03144:Tep1	APN	14	50844017	splice site	probably benign
IGL03209:Tep1	APN	14	50840703	splice site	probably benign
R0240_Tep1_347	UTSW	14	50863029	splice site	probably benign
R0972_Tep1_893	UTSW	14	50824296	unclassified	probably benign
R1686_Tep1_375	UTSW	14	50836788	missense	probably benign	0.12
R7232_Tep1_671	UTSW	14	50844332	missense	unknown
R8009_Tep1_822	UTSW	14	50824230	missense	possibly damaging	0.93
PIT4305001:Tep1	UTSW	14	50829227	missense	possibly damaging	0.90
PIT4362001:Tep1	UTSW	14	50866053	missense	probably benign	0.23
R0058:Tep1	UTSW	14	50834065	missense	possibly damaging	0.85
R0060:Tep1	UTSW	14	50866029	missense	probably damaging	1.00
R0109:Tep1	UTSW	14	50851916	splice site	probably null
R0123:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0134:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0148:Tep1	UTSW	14	50824789	missense	possibly damaging	0.70
R0240:Tep1	UTSW	14	50863029	splice site	probably benign
R0243:Tep1	UTSW	14	50846987	missense	probably damaging	1.00
R0373:Tep1	UTSW	14	50836768	missense	possibly damaging	0.85
R0432:Tep1	UTSW	14	50866823	small deletion	probably benign
R0464:Tep1	UTSW	14	50847684	missense	probably benign	0.00
R0566:Tep1	UTSW	14	50845414	critical splice donor site	probably null
R0691:Tep1	UTSW	14	50866844	nonsense	probably null
R0787:Tep1	UTSW	14	50829230	missense	possibly damaging	0.85
R0972:Tep1	UTSW	14	50824296	unclassified	probably benign
R1263:Tep1	UTSW	14	50845513	missense	possibly damaging	0.84
R1300:Tep1	UTSW	14	50827055	critical splice donor site	probably null
R1327:Tep1	UTSW	14	50853099	missense	probably benign	0.18
R1556:Tep1	UTSW	14	50853042	missense	probably benign	0.06
R1584:Tep1	UTSW	14	50866037	missense	probably damaging	0.98
R1607:Tep1	UTSW	14	50824563	missense	probably null	0.99
R1686:Tep1	UTSW	14	50836788	missense	probably benign	0.12
R1715:Tep1	UTSW	14	50854567	missense	possibly damaging	0.92
R1778:Tep1	UTSW	14	50829622	intron	probably benign
R1993:Tep1	UTSW	14	50824184	missense	possibly damaging	0.93
R2071:Tep1	UTSW	14	50854282	missense	probably benign	0.23
R2104:Tep1	UTSW	14	50850580	splice site	probably benign
R2118:Tep1	UTSW	14	50855572	splice site	probably null
R2119:Tep1	UTSW	14	50838986	missense	probably benign	0.13
R2208:Tep1	UTSW	14	50866864	missense	probably benign	0.01
R2241:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2243:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2311:Tep1	UTSW	14	50833567	missense	possibly damaging	0.95
R2420:Tep1	UTSW	14	50834023	missense	probably benign
R2874:Tep1	UTSW	14	50850650	missense	possibly damaging	0.71
R3084:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3086:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3621:Tep1	UTSW	14	50829020	missense	probably damaging	0.99
R3815:Tep1	UTSW	14	50868315	missense	possibly damaging	0.71
R4124:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4125:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4127:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4134:Tep1	UTSW	14	50844860	missense	probably benign
R4152:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4153:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4191:Tep1	UTSW	14	50836806	missense	probably damaging	0.96
R4248:Tep1	UTSW	14	50862894	missense	possibly damaging	0.93
R4293:Tep1	UTSW	14	50846861	missense	probably benign
R4569:Tep1	UTSW	14	50824740	missense	probably benign	0.01
R4704:Tep1	UTSW	14	50837073	missense	probably benign	0.06
R4815:Tep1	UTSW	14	50841302	missense	probably damaging	0.99
R4978:Tep1	UTSW	14	50845434	missense	possibly damaging	0.93
R4989:Tep1	UTSW	14	50839000	missense	probably benign
R5022:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5057:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5063:Tep1	UTSW	14	50850627	missense	possibly damaging	0.86
R5118:Tep1	UTSW	14	50855587	splice site	probably null
R5128:Tep1	UTSW	14	50844279	makesense	probably null
R5149:Tep1	UTSW	14	50837398	nonsense	probably null
R5171:Tep1	UTSW	14	50824802	missense	probably benign	0.01
R5201:Tep1	UTSW	14	50868110	missense	probably benign	0.01
R5339:Tep1	UTSW	14	50844574	missense	probably damaging	0.99
R5384:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5385:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5386:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5594:Tep1	UTSW	14	50829882	missense	possibly damaging	0.86
R5639:Tep1	UTSW	14	50853605	missense	possibly damaging	0.85
R5749:Tep1	UTSW	14	50844072	missense	possibly damaging	0.59
R5756:Tep1	UTSW	14	50837379	critical splice donor site	probably null
R6013:Tep1	UTSW	14	50861048	missense	probably damaging	0.97
R6014:Tep1	UTSW	14	50847000	missense	probably benign	0.12
R6248:Tep1	UTSW	14	50830258	missense	probably damaging	0.98
R6264:Tep1	UTSW	14	50845513	missense	probably damaging	0.99
R6363:Tep1	UTSW	14	50824548	missense	probably benign	0.04
R6381:Tep1	UTSW	14	50845431	missense	probably damaging	0.99
R6462:Tep1	UTSW	14	50844379	missense	probably benign
R6942:Tep1	UTSW	14	50836737	missense	possibly damaging	0.85
R6951:Tep1	UTSW	14	50833913	critical splice donor site	probably null
R6979:Tep1	UTSW	14	50838637	missense	possibly damaging	0.93
R6999:Tep1	UTSW	14	50850705	missense	possibly damaging	0.86
R7099:Tep1	UTSW	14	50844487	splice site	probably null
R7208:Tep1	UTSW	14	50824556	critical splice acceptor site	probably null
R7232:Tep1	UTSW	14	50844332	missense	unknown
R7249:Tep1	UTSW	14	50824275	missense	possibly damaging	0.86
R7325:Tep1	UTSW	14	50866038	missense	probably damaging	0.99
R7409:Tep1	UTSW	14	50866855	missense	possibly damaging	0.67
R7499:Tep1	UTSW	14	50853590	missense	probably damaging	0.99
R7542:Tep1	UTSW	14	50862491	nonsense	probably null
R7806:Tep1	UTSW	14	50836809	missense	possibly damaging	0.85
R7825:Tep1	UTSW	14	50843887	critical splice acceptor site	probably null
R7901:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R7961:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R7993:Tep1	UTSW	14	50830253	missense	probably benign	0.41
R8009:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R8085:Tep1	UTSW	14	50829296	missense	probably benign	0.11
R8299:Tep1	UTSW	14	50868045	missense	probably benign	0.06
R8330:Tep1	UTSW	14	50847705	missense	possibly damaging	0.86
R8396:Tep1	UTSW	14	50837072	missense	probably benign	0.23
R8475:Tep1	UTSW	14	50841255	missense	probably damaging	1.00
R8695:Tep1	UTSW	14	50845437	missense	possibly damaging	0.85
R8726:Tep1	UTSW	14	50847623	missense	probably damaging	0.98
R8812:Tep1	UTSW	14	50837132	missense	probably damaging	0.98
R9152:Tep1	UTSW	14	50866705	missense	probably benign	0.14
R9269:Tep1	UTSW	14	50844309	missense	probably damaging	0.98
R9299:Tep1	UTSW	14	50844531	splice site	probably benign
R9365:Tep1	UTSW	14	50827140	missense	probably damaging	1.00
R9398:Tep1	UTSW	14	50828972	missense	possibly damaging	0.85
R9408:Tep1	UTSW	14	50837180	missense	possibly damaging	0.85
R9445:Tep1	UTSW	14	50845510	missense	possibly damaging	0.95
R9487:Tep1	UTSW	14	50829230	missense	possibly damaging	0.93
R9555:Tep1	UTSW	14	50868431	missense	possibly damaging	0.52
R9597:Tep1	UTSW	14	50863008	missense	probably damaging	0.99
R9715:Tep1	UTSW	14	50844302	missense
R9732:Tep1	UTSW	14	50850705	missense	probably benign	0.33
R9777:Tep1	UTSW	14	50838986	nonsense	probably null
RF007:Tep1	UTSW	14	50860945	missense	possibly damaging	0.92
X0024:Tep1	UTSW	14	50827119	missense	possibly damaging	0.86
X0060:Tep1	UTSW	14	50836764	missense	probably benign	0.25
Z1177:Tep1	UTSW	14	50847765	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGGATGGGCTTGGCTTGAC -3'
(R):5'- CCAGAACTACTGTGCAGAGAGG -3'

Sequencing Primer
(F):5'- CTTGGCTTGACTGGACCGTC -3'
(R):5'- GAGACCAGAAGTACTGTGCAG -3'

Posted On

2016-07-06