Incidental Mutation 'R5260:Acin1'
ID401397
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Nameapoptotic chromatin condensation inducer 1
Synonyms2610510L13Rik, Acinus, 2610036I19Rik
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R5260 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54642161-54686931 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 54642822 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000022794] [ENSMUST00000067784] [ENSMUST00000111484] [ENSMUST00000123875] [ENSMUST00000126166] [ENSMUST00000141453] [ENSMUST00000148754] [ENSMUST00000150371] [ENSMUST00000167015] [ENSMUST00000169818]
Predicted Effect unknown
Transcript: ENSMUST00000022793
AA Change: D1308G
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185
AA Change: D1308G

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000022794
AA Change: D550G
SMART Domains Protein: ENSMUSP00000022794
Gene: ENSMUSG00000022185
AA Change: D550G

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 169 194 N/A INTRINSIC
RRM 254 323 8.3e-2 SMART
low complexity region 355 405 N/A INTRINSIC
low complexity region 412 450 N/A INTRINSIC
PDB:4A8X|B 451 475 4e-6 PDB
low complexity region 477 512 N/A INTRINSIC
low complexity region 517 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067784
SMART Domains Protein: ENSMUSP00000066005
Gene: ENSMUSG00000059674

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 67 148 7.85e-18 SMART
CA 172 257 3.23e-28 SMART
CA 281 369 4.24e-14 SMART
CA 396 477 1.48e-22 SMART
Blast:CA 500 581 3e-31 BLAST
transmembrane domain 602 624 N/A INTRINSIC
Pfam:Cadherin_C 627 775 2e-48 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000111484
AA Change: D1268G
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185
AA Change: D1268G

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123875
SMART Domains Protein: ENSMUSP00000117210
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125767
Predicted Effect unknown
Transcript: ENSMUST00000126166
AA Change: D535G
SMART Domains Protein: ENSMUSP00000114546
Gene: ENSMUSG00000022185
AA Change: D535G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 154 179 N/A INTRINSIC
RRM 239 308 8.3e-2 SMART
low complexity region 340 390 N/A INTRINSIC
low complexity region 397 435 N/A INTRINSIC
PDB:4A8X|B 436 460 4e-6 PDB
low complexity region 462 497 N/A INTRINSIC
low complexity region 502 556 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133706
Predicted Effect probably benign
Transcript: ENSMUST00000138321
SMART Domains Protein: ENSMUSP00000119326
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
Pfam:RSB_motif 20 128 4.7e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141453
AA Change: D522G
SMART Domains Protein: ENSMUSP00000116664
Gene: ENSMUSG00000022185
AA Change: D522G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 30 40 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
RRM 226 295 8.3e-2 SMART
low complexity region 327 377 N/A INTRINSIC
low complexity region 384 422 N/A INTRINSIC
PDB:4A8X|B 423 447 4e-6 PDB
low complexity region 449 484 N/A INTRINSIC
low complexity region 489 543 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000147714
AA Change: D1241G
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185
AA Change: D1241G

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148754
AA Change: D551G
SMART Domains Protein: ENSMUSP00000122003
Gene: ENSMUSG00000022185
AA Change: D551G

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150371
AA Change: D604G
SMART Domains Protein: ENSMUSP00000118069
Gene: ENSMUSG00000022185
AA Change: D604G

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 223 248 N/A INTRINSIC
RRM 308 377 8.3e-2 SMART
low complexity region 409 459 N/A INTRINSIC
low complexity region 466 504 N/A INTRINSIC
PDB:4A8X|B 505 529 3e-6 PDB
low complexity region 531 566 N/A INTRINSIC
low complexity region 571 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152773
Predicted Effect unknown
Transcript: ENSMUST00000167015
AA Change: D551G
SMART Domains Protein: ENSMUSP00000125776
Gene: ENSMUSG00000022185
AA Change: D551G

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
RRM 255 324 8.3e-2 SMART
low complexity region 356 406 N/A INTRINSIC
low complexity region 413 451 N/A INTRINSIC
PDB:4A8X|B 452 476 4e-6 PDB
low complexity region 478 513 N/A INTRINSIC
low complexity region 518 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167495
Predicted Effect probably benign
Transcript: ENSMUST00000169818
SMART Domains Protein: ENSMUSP00000131860
Gene: ENSMUSG00000091306

DomainStartEndE-ValueType
low complexity region 1 61 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196776
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54646800 missense probably damaging 1.00
IGL01530:Acin1 APN 14 54643986 missense probably damaging 1.00
IGL02396:Acin1 APN 14 54644799 intron probably benign
IGL02967:Acin1 APN 14 54642753 missense possibly damaging 0.80
Protuberant UTSW 14 54645283 missense probably damaging 1.00
R0411:Acin1 UTSW 14 54646774 missense probably damaging 1.00
R0723:Acin1 UTSW 14 54665451 missense probably damaging 0.98
R0755:Acin1 UTSW 14 54651835 start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54653528 unclassified probably benign
R1600:Acin1 UTSW 14 54643717 intron probably benign
R1682:Acin1 UTSW 14 54663718 missense probably damaging 1.00
R1721:Acin1 UTSW 14 54664538 missense probably benign 0.01
R1756:Acin1 UTSW 14 54665204 missense probably benign 0.30
R1867:Acin1 UTSW 14 54644261 missense probably damaging 1.00
R1997:Acin1 UTSW 14 54646699 splice site probably null
R2067:Acin1 UTSW 14 54665254 missense probably damaging 1.00
R3947:Acin1 UTSW 14 54679333 missense possibly damaging 0.89
R4374:Acin1 UTSW 14 54653894 unclassified probably benign
R4476:Acin1 UTSW 14 54645330 missense probably damaging 1.00
R4501:Acin1 UTSW 14 54686587 missense probably damaging 1.00
R4547:Acin1 UTSW 14 54645667 missense probably benign 0.01
R4621:Acin1 UTSW 14 54653443 unclassified probably benign
R4657:Acin1 UTSW 14 54643047 missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54686758 missense probably benign 0.00
R4696:Acin1 UTSW 14 54643017 intron probably benign
R4806:Acin1 UTSW 14 54679228 splice site probably benign
R4826:Acin1 UTSW 14 54664617 missense probably damaging 0.97
R5096:Acin1 UTSW 14 54679222 intron probably benign
R5153:Acin1 UTSW 14 54645613 missense probably benign 0.25
R5223:Acin1 UTSW 14 54642941 frame shift probably null
R5525:Acin1 UTSW 14 54664391 missense possibly damaging 0.94
R5575:Acin1 UTSW 14 54678738 splice site probably null
R5902:Acin1 UTSW 14 54663673 missense probably benign 0.01
R6211:Acin1 UTSW 14 54644046 missense probably damaging 1.00
R6524:Acin1 UTSW 14 54645283 missense probably damaging 1.00
R6560:Acin1 UTSW 14 54678833 missense probably benign 0.24
R6916:Acin1 UTSW 14 54665416 missense probably benign 0.27
R7201:Acin1 UTSW 14 54664899 missense possibly damaging 0.83
X0021:Acin1 UTSW 14 54667101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTGGTGACTGTACCTATCC -3'
(R):5'- ACTGTGACACACTTCTCTGC -3'

Sequencing Primer
(F):5'- GTGACTGTACCTATCCCTCTGTGG -3'
(R):5'- TCTGACCACAGATTGTTCAGAAGG -3'
Posted On2016-07-06