Incidental Mutation 'R5260:Krt82'
ID 401404
Institutional Source Beutler Lab
Gene Symbol Krt82
Ensembl Gene ENSMUSG00000049548
Gene Name keratin 82
Synonyms Krt2-20
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 101541214-101550667 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 101548388 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 186 (G186C)
Ref Sequence ENSEMBL: ENSMUSP00000023713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023713] [ENSMUST00000023714]
AlphaFold Q99M74
Predicted Effect possibly damaging
Transcript: ENSMUST00000023713
AA Change: G186C

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023713
Gene: ENSMUSG00000049548
AA Change: G186C

DomainStartEndE-ValueType
low complexity region 38 57 N/A INTRINSIC
Pfam:Keratin_2_head 61 114 6.1e-13 PFAM
Filament 117 428 1.32e-153 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023714
SMART Domains Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 139 3.1e-24 PFAM
Filament 142 453 1.05e-179 SMART
low complexity region 465 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this keratin appears to be a hair cuticle-specific keratin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Krt82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Krt82 APN 15 101543378 missense probably damaging 0.97
IGL01112:Krt82 APN 15 101545523 missense probably damaging 1.00
IGL01820:Krt82 APN 15 101543452 splice site probably benign
IGL02529:Krt82 APN 15 101550396 nonsense probably null
IGL02894:Krt82 APN 15 101542720 missense probably damaging 1.00
IGL02974:Krt82 APN 15 101550585 nonsense probably null
IGL03263:Krt82 APN 15 101541872 missense probably benign 0.00
R0268:Krt82 UTSW 15 101541713 missense probably benign 0.02
R0385:Krt82 UTSW 15 101545593 missense probably damaging 1.00
R0542:Krt82 UTSW 15 101545600 splice site probably benign
R1073:Krt82 UTSW 15 101550254 missense probably damaging 1.00
R1601:Krt82 UTSW 15 101545153 missense probably damaging 1.00
R1795:Krt82 UTSW 15 101543384 missense possibly damaging 0.90
R1944:Krt82 UTSW 15 101548535 missense probably damaging 1.00
R1974:Krt82 UTSW 15 101545162 missense probably benign 0.00
R2049:Krt82 UTSW 15 101545156 missense probably damaging 0.96
R2140:Krt82 UTSW 15 101545156 missense probably damaging 0.96
R2851:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R2852:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R2853:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R3815:Krt82 UTSW 15 101550600 missense probably damaging 1.00
R4324:Krt82 UTSW 15 101541747 missense probably benign 0.00
R4798:Krt82 UTSW 15 101550488 missense probably benign 0.01
R4980:Krt82 UTSW 15 101545099 missense possibly damaging 0.85
R5212:Krt82 UTSW 15 101545049 missense probably damaging 1.00
R5821:Krt82 UTSW 15 101548385 nonsense probably null
R6009:Krt82 UTSW 15 101545105 missense probably benign 0.00
R6955:Krt82 UTSW 15 101542849 missense probably damaging 1.00
R7194:Krt82 UTSW 15 101542756 missense probably damaging 1.00
R7307:Krt82 UTSW 15 101542907 missense probably damaging 0.97
R7420:Krt82 UTSW 15 101545587 missense probably damaging 0.96
R7837:Krt82 UTSW 15 101548357 missense possibly damaging 0.86
R8354:Krt82 UTSW 15 101541803 missense probably damaging 1.00
R8371:Krt82 UTSW 15 101545111 missense probably benign 0.12
R8454:Krt82 UTSW 15 101541803 missense probably damaging 1.00
R8692:Krt82 UTSW 15 101548393 missense possibly damaging 0.75
R9111:Krt82 UTSW 15 101543351 missense probably benign 0.01
R9187:Krt82 UTSW 15 101541825 missense probably benign 0.01
R9346:Krt82 UTSW 15 101550524 missense probably benign
R9527:Krt82 UTSW 15 101546123 missense probably benign 0.39
Z1176:Krt82 UTSW 15 101541852 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCCTGCACTACTCAGTTG -3'
(R):5'- ATACATCCCTCTGGGTGTTAGTC -3'

Sequencing Primer
(F):5'- GCACTACTCAGTTGTTTTCGTG -3'
(R):5'- TCTGCAGAGACCTGGCGATG -3'
Posted On 2016-07-06