Incidental Mutation 'R5260:Golgb1'
ID401406
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Namegolgi autoantigen, golgin subfamily b, macrogolgin 1
SynonymsGiantin, C130074L01Rik, F730017E11Rik, Gm6840, 6330407A06Rik
MMRRC Submission 042829-MU
Accession Numbers

Genbank: NM_030035.1

Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R5260 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location36875140-36933085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36913141 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 917 (S917C)
Ref Sequence ENSEMBL: ENSMUSP00000110460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812]
Predicted Effect probably benign
Transcript: ENSMUST00000039855
AA Change: S958C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: S958C

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
AA Change: S917C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: S917C

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36931564 missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36915502 nonsense probably null
IGL01965:Golgb1 APN 16 36917920 missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36916304 missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36913128 missense probably benign 0.25
IGL02383:Golgb1 APN 16 36886200 missense probably benign 0.01
IGL02444:Golgb1 APN 16 36907816 splice site probably benign
IGL02635:Golgb1 APN 16 36915013 missense probably benign 0.00
IGL02655:Golgb1 APN 16 36918080 missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36925849 missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36916210 missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36912080 missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36925810 missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36912866 missense probably benign 0.11
IGL03109:Golgb1 APN 16 36915611 missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36913453 nonsense probably null
I2288:Golgb1 UTSW 16 36898542 missense probably benign 0.00
I2289:Golgb1 UTSW 16 36898542 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0071:Golgb1 UTSW 16 36915503 missense probably benign 0.00
R0080:Golgb1 UTSW 16 36898611 missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36875468 intron probably benign
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0242:Golgb1 UTSW 16 36875630 nonsense probably null
R0276:Golgb1 UTSW 16 36913876 missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36875579 intron probably benign
R0469:Golgb1 UTSW 16 36931635 missense probably benign 0.41
R0522:Golgb1 UTSW 16 36915205 frame shift probably null
R0575:Golgb1 UTSW 16 36918809 missense probably benign
R0600:Golgb1 UTSW 16 36916271 missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36916330 nonsense probably null
R0711:Golgb1 UTSW 16 36918790 missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36898790 missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36912277 missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36916126 missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36915205 frame shift probably null
R1315:Golgb1 UTSW 16 36914900 missense probably benign 0.40
R1429:Golgb1 UTSW 16 36900563 missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36919643 missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36898788 missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36926101 missense probably benign 0.25
R1659:Golgb1 UTSW 16 36887617 missense probably benign 0.01
R1769:Golgb1 UTSW 16 36916001 missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36914664 missense probably benign
R2212:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36893360 missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36898559 missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36912008 missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36918466 missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36915151 missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36894849 missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36887347 missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36918912 missense probably benign 0.00
R3847:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3850:Golgb1 UTSW 16 36898733 missense probably benign 0.00
R3936:Golgb1 UTSW 16 36914056 nonsense probably null
R3975:Golgb1 UTSW 16 36918571 missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36915344 missense probably benign 0.00
R4369:Golgb1 UTSW 16 36916907 missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36929263 missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36918625 missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36887618 missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36891419 missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36913115 missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36891407 missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36893386 missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36916118 missense probably benign 0.05
R5121:Golgb1 UTSW 16 36919258 missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36891457 missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36898689 missense probably benign 0.09
R5185:Golgb1 UTSW 16 36875141 unclassified probably benign
R5188:Golgb1 UTSW 16 36918465 missense probably benign 0.13
R5297:Golgb1 UTSW 16 36875616 intron probably benign
R5386:Golgb1 UTSW 16 36912315 nonsense probably null
R5438:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5439:Golgb1 UTSW 16 36900508 missense probably benign 0.15
R5494:Golgb1 UTSW 16 36928683 missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36925763 missense probably benign 0.02
R5740:Golgb1 UTSW 16 36919000 missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36926091 splice site silent
R5928:Golgb1 UTSW 16 36911987 missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36914959 missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36914671 missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36912865 missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36893395 missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36915622 missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36913978 missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36918197 nonsense probably null
R6700:Golgb1 UTSW 16 36875584 intron probably benign
R6870:Golgb1 UTSW 16 36918203 missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36913990 missense probably benign
R6944:Golgb1 UTSW 16 36912113 missense probably benign
R7108:Golgb1 UTSW 16 36913721 missense probably benign 0.01
R7124:Golgb1 UTSW 16 36913673 missense probably benign 0.01
R7125:Golgb1 UTSW 16 36917963 missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36916150 missense probably benign 0.43
R7205:Golgb1 UTSW 16 36875301 missense unknown
R7206:Golgb1 UTSW 16 36913749 missense probably benign 0.41
R7233:Golgb1 UTSW 16 36914758 missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36915951 nonsense probably null
R7367:Golgb1 UTSW 16 36898546 missense probably benign 0.00
R7408:Golgb1 UTSW 16 36898547 missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36912919 missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36915793 missense probably benign 0.03
R7599:Golgb1 UTSW 16 36875396 missense unknown
R7673:Golgb1 UTSW 16 36913669 missense probably benign 0.05
R7789:Golgb1 UTSW 16 36875399 missense unknown
R7792:Golgb1 UTSW 16 36918730 missense probably benign 0.43
R7830:Golgb1 UTSW 16 36898721 missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36931920 missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36913685 missense probably benign
R7944:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7945:Golgb1 UTSW 16 36914104 missense probably benign 0.02
R7950:Golgb1 UTSW 16 36915424 missense probably benign 0.13
R8040:Golgb1 UTSW 16 36913479 missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36918633 missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36916830 missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36912317 missense probably benign 0.00
R8684:Golgb1 UTSW 16 36914402 missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36919201 missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36919201 missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36916313 missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36919744 missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36915689 missense probably benign
R8825:Golgb1 UTSW 16 36919447 missense probably benign 0.00
R8940:Golgb1 UTSW 16 36916397 missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36913616 missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36898542 missense probably benign 0.00
X0067:Golgb1 UTSW 16 36914303 nonsense probably null
Z1088:Golgb1 UTSW 16 36919742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGCAGGCTCTTTCTCAG -3'
(R):5'- AGAGTCCTCTCTCACCTTGG -3'

Sequencing Primer
(F):5'- GCCAAGATGGACCAACTCTTGTTAG -3'
(R):5'- GGCTAGCTCCTCCTCCAG -3'
Posted On2016-07-06