Incidental Mutation 'R5260:Chaf1a'
ID 401409
Institutional Source Beutler Lab
Gene Symbol Chaf1a
Ensembl Gene ENSMUSG00000002835
Gene Name chromatin assembly factor 1, subunit A
Synonyms CAF-1, p150
MMRRC Submission 042829-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 56347416-56375026 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 56372000 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 723 (H723Y)
Ref Sequence ENSEMBL: ENSMUSP00000002914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002914] [ENSMUST00000019722]
AlphaFold Q9QWF0
PDB Structure HP1 chromo shadow domain in complex with PXVXL motif of CAF-1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000002914
AA Change: H723Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002914
Gene: ENSMUSG00000002835
AA Change: H723Y

DomainStartEndE-ValueType
Pfam:CAF1-p150_N 1 210 3.8e-59 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:CAF-1_p150 299 458 1e-49 PFAM
low complexity region 466 481 N/A INTRINSIC
Pfam:CAF1A 537 611 1.1e-25 PFAM
Pfam:CAF1-p150_C2 644 908 1.6e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019722
SMART Domains Protein: ENSMUSP00000019722
Gene: ENSMUSG00000019578

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
Pfam:PUB 168 255 1.6e-27 PFAM
UBX 329 410 1.03e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153947
Meta Mutation Damage Score 0.6869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromatin assembly factor I (CAF1) is a nuclear complex consisting of p50, p60 (CHAF1B; MIM 601245), and p150 (CHAF1A) subunits that assembles histone octamers onto replicating DNA in vitro (Kaufman et al., 1995 [PubMed 7600578]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation in this gene display lethality before implantation, embryonic growth arrest, and abnormal heterochromatin morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A T 7: 132,461,003 (GRCm39) I14F probably damaging Het
Acin1 T C 14: 54,880,279 (GRCm39) probably benign Het
Adamts9 C A 6: 92,784,118 (GRCm39) V1579L probably benign Het
Adra2a T A 19: 54,035,039 (GRCm39) C132S probably damaging Het
Aif1 T A 17: 35,390,917 (GRCm39) probably null Het
Atf5 A T 7: 44,464,510 (GRCm39) Y27* probably null Het
Atm A G 9: 53,417,911 (GRCm39) S799P probably damaging Het
Bmp2k T G 5: 97,235,210 (GRCm39) probably benign Het
Clint1 T C 11: 45,798,769 (GRCm39) W493R probably damaging Het
Cyb561a3 T A 19: 10,565,230 (GRCm39) V198D possibly damaging Het
Cyp2j8 T C 4: 96,389,301 (GRCm39) E174G possibly damaging Het
Cyp4v3 C T 8: 45,760,017 (GRCm39) G512S probably damaging Het
Dnah8 T A 17: 30,919,393 (GRCm39) V1122D probably benign Het
Doc2b C A 11: 75,676,989 (GRCm39) G128V probably damaging Het
Dysf T C 6: 84,127,016 (GRCm39) V1378A probably damaging Het
Efcab5 A T 11: 77,028,477 (GRCm39) S421T possibly damaging Het
Efcab6 T G 15: 83,829,324 (GRCm39) D672A probably benign Het
Eif2ak3 C A 6: 70,870,113 (GRCm39) H933Q probably damaging Het
Erc1 A T 6: 119,738,120 (GRCm39) N574K probably damaging Het
Eri2 A T 7: 119,387,069 (GRCm39) probably benign Het
Faxc A G 4: 21,948,744 (GRCm39) Y152C probably damaging Het
Fbxl7 T A 15: 26,543,585 (GRCm39) Y354F probably damaging Het
Fras1 T A 5: 96,883,046 (GRCm39) I2526N possibly damaging Het
Gm5424 A T 10: 61,907,374 (GRCm39) noncoding transcript Het
Gm6728 T C 6: 136,463,701 (GRCm39) noncoding transcript Het
Golgb1 A T 16: 36,733,503 (GRCm39) S917C probably benign Het
Gtpbp3 T C 8: 71,942,062 (GRCm39) probably benign Het
Gusb A T 5: 130,028,829 (GRCm39) Y220* probably null Het
Gvin3 A G 7: 106,198,411 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,471,612 (GRCm39) V4914A possibly damaging Het
Iars2 C A 1: 185,055,931 (GRCm39) C211F probably damaging Het
Kif5b A G 18: 6,211,058 (GRCm39) L802P probably damaging Het
Kif5c A G 2: 49,625,602 (GRCm39) E624G probably damaging Het
Kmt2d G T 15: 98,740,741 (GRCm39) probably benign Het
Krt82 C A 15: 101,456,823 (GRCm39) G186C possibly damaging Het
Lca5 G A 9: 83,305,276 (GRCm39) R177C probably damaging Het
Mab21l4 A T 1: 93,087,700 (GRCm39) V51E probably damaging Het
Mier1 T C 4: 103,019,907 (GRCm39) S318P probably benign Het
Obscn A T 11: 58,894,195 (GRCm39) I1207N probably damaging Het
Oog4 C T 4: 143,164,424 (GRCm39) G369D probably benign Het
Or4c126 A G 2: 89,824,526 (GRCm39) D263G probably damaging Het
Or4k52 A G 2: 111,611,526 (GRCm39) Y287C probably damaging Het
Or52d13 A G 7: 103,109,822 (GRCm39) F198L probably benign Het
Or5d35 A C 2: 87,855,818 (GRCm39) I251L probably benign Het
Plec T C 15: 76,060,824 (GRCm39) T3060A probably damaging Het
Plekhh2 C T 17: 84,884,593 (GRCm39) T769I probably damaging Het
Prkaa1 A T 15: 5,190,149 (GRCm39) S65C probably damaging Het
Psma3 T C 12: 71,031,416 (GRCm39) probably benign Het
Ptpn18 T A 1: 34,502,591 (GRCm39) probably benign Het
Ptprv T C 1: 135,039,998 (GRCm39) noncoding transcript Het
Rac1 C A 5: 143,493,886 (GRCm39) V104L probably benign Het
Serpinb7 A T 1: 107,362,479 (GRCm39) N61I possibly damaging Het
Sirt7 A C 11: 120,511,347 (GRCm39) probably benign Het
Srl G A 16: 4,300,759 (GRCm39) R333* probably null Het
Srprb A T 9: 103,079,119 (GRCm39) L756Q probably damaging Het
Tchhl1 T C 3: 93,378,102 (GRCm39) S269P probably damaging Het
Tdo2 C T 3: 81,882,630 (GRCm39) probably null Het
Teddm1a T C 1: 153,767,646 (GRCm39) Y37H probably benign Het
Tenm3 T C 8: 48,689,890 (GRCm39) Y1899C probably damaging Het
Tep1 T C 14: 51,076,088 (GRCm39) T1681A probably benign Het
Timm44 G T 8: 4,325,919 (GRCm39) probably null Het
Trp73 A G 4: 154,147,059 (GRCm39) V322A possibly damaging Het
Tsr1 A C 11: 74,796,781 (GRCm39) E611A probably damaging Het
Unc80 A G 1: 66,685,746 (GRCm39) N2290S possibly damaging Het
Ush2a T C 1: 188,679,276 (GRCm39) V4828A possibly damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnt9b C A 11: 103,622,875 (GRCm39) S176I possibly damaging Het
Zfp329 A G 7: 12,540,453 (GRCm39) probably benign Het
Zfp352 T A 4: 90,112,697 (GRCm39) V279D probably damaging Het
Zfp932 C T 5: 110,157,501 (GRCm39) Q400* probably null Het
Zxdc T A 6: 90,359,075 (GRCm39) L569Q probably damaging Het
Other mutations in Chaf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Chaf1a APN 17 56,370,336 (GRCm39) missense possibly damaging 0.75
IGL01318:Chaf1a APN 17 56,366,336 (GRCm39) splice site probably benign
IGL01344:Chaf1a APN 17 56,371,104 (GRCm39) missense probably damaging 1.00
IGL02740:Chaf1a APN 17 56,374,500 (GRCm39) missense probably damaging 1.00
IGL03328:Chaf1a APN 17 56,370,374 (GRCm39) missense probably damaging 1.00
R0077:Chaf1a UTSW 17 56,354,384 (GRCm39) missense unknown
R0318:Chaf1a UTSW 17 56,369,227 (GRCm39) missense possibly damaging 0.73
R0945:Chaf1a UTSW 17 56,374,441 (GRCm39) missense probably damaging 1.00
R1370:Chaf1a UTSW 17 56,371,032 (GRCm39) missense probably benign 0.31
R1520:Chaf1a UTSW 17 56,354,302 (GRCm39) missense unknown
R1641:Chaf1a UTSW 17 56,354,380 (GRCm39) missense unknown
R1669:Chaf1a UTSW 17 56,370,339 (GRCm39) missense probably benign 0.45
R1955:Chaf1a UTSW 17 56,354,540 (GRCm39) missense unknown
R2139:Chaf1a UTSW 17 56,372,226 (GRCm39) missense probably damaging 1.00
R2879:Chaf1a UTSW 17 56,351,114 (GRCm39) critical splice donor site probably null
R4258:Chaf1a UTSW 17 56,363,474 (GRCm39) missense unknown
R4303:Chaf1a UTSW 17 56,351,068 (GRCm39) missense unknown
R4577:Chaf1a UTSW 17 56,372,184 (GRCm39) missense probably damaging 1.00
R5254:Chaf1a UTSW 17 56,369,606 (GRCm39) missense probably benign 0.19
R5976:Chaf1a UTSW 17 56,371,115 (GRCm39) missense probably damaging 1.00
R6746:Chaf1a UTSW 17 56,370,404 (GRCm39) missense possibly damaging 0.77
R6799:Chaf1a UTSW 17 56,354,059 (GRCm39) missense unknown
R7327:Chaf1a UTSW 17 56,369,573 (GRCm39) missense probably benign 0.00
R7445:Chaf1a UTSW 17 56,369,170 (GRCm39) missense possibly damaging 0.85
R7565:Chaf1a UTSW 17 56,371,148 (GRCm39) missense probably benign 0.00
R7782:Chaf1a UTSW 17 56,369,291 (GRCm39) missense probably benign 0.02
R7864:Chaf1a UTSW 17 56,354,339 (GRCm39) missense unknown
R8313:Chaf1a UTSW 17 56,351,109 (GRCm39) missense unknown
R9035:Chaf1a UTSW 17 56,371,110 (GRCm39) missense probably damaging 0.98
R9477:Chaf1a UTSW 17 56,369,244 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCACATGGCATTGCTCAGG -3'
(R):5'- ATACCAGCACATACGGAAGTTGG -3'

Sequencing Primer
(F):5'- GCATTGCTCAGGGCCAC -3'
(R):5'- CTTCTCATAGGCAGAGTTCTCAGAG -3'
Posted On 2016-07-06