Incidental Mutation 'R5260:Chaf1a'
ID 401409
Institutional Source Beutler Lab
Gene Symbol Chaf1a
Ensembl Gene ENSMUSG00000002835
Gene Name chromatin assembly factor 1, subunit A (p150)
Synonyms CAF-1
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 56040416-56068026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 56065000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 723 (H723Y)
Ref Sequence ENSEMBL: ENSMUSP00000002914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002914] [ENSMUST00000019722]
AlphaFold Q9QWF0
PDB Structure HP1 chromo shadow domain in complex with PXVXL motif of CAF-1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000002914
AA Change: H723Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002914
Gene: ENSMUSG00000002835
AA Change: H723Y

DomainStartEndE-ValueType
Pfam:CAF1-p150_N 1 210 3.8e-59 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:CAF-1_p150 299 458 1e-49 PFAM
low complexity region 466 481 N/A INTRINSIC
Pfam:CAF1A 537 611 1.1e-25 PFAM
Pfam:CAF1-p150_C2 644 908 1.6e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019722
SMART Domains Protein: ENSMUSP00000019722
Gene: ENSMUSG00000019578

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
Pfam:PUB 168 255 1.6e-27 PFAM
UBX 329 410 1.03e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153947
Meta Mutation Damage Score 0.6869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromatin assembly factor I (CAF1) is a nuclear complex consisting of p50, p60 (CHAF1B; MIM 601245), and p150 (CHAF1A) subunits that assembles histone octamers onto replicating DNA in vitro (Kaufman et al., 1995 [PubMed 7600578]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation in this gene display lethality before implantation, embryonic growth arrest, and abnormal heterochromatin morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Chaf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Chaf1a APN 17 56063336 missense possibly damaging 0.75
IGL01318:Chaf1a APN 17 56059336 splice site probably benign
IGL01344:Chaf1a APN 17 56064104 missense probably damaging 1.00
IGL02740:Chaf1a APN 17 56067500 missense probably damaging 1.00
IGL03328:Chaf1a APN 17 56063374 missense probably damaging 1.00
R0077:Chaf1a UTSW 17 56047384 missense unknown
R0318:Chaf1a UTSW 17 56062227 missense possibly damaging 0.73
R0945:Chaf1a UTSW 17 56067441 missense probably damaging 1.00
R1370:Chaf1a UTSW 17 56064032 missense probably benign 0.31
R1520:Chaf1a UTSW 17 56047302 missense unknown
R1641:Chaf1a UTSW 17 56047380 missense unknown
R1669:Chaf1a UTSW 17 56063339 missense probably benign 0.45
R1955:Chaf1a UTSW 17 56047540 missense unknown
R2139:Chaf1a UTSW 17 56065226 missense probably damaging 1.00
R2879:Chaf1a UTSW 17 56044114 critical splice donor site probably null
R4258:Chaf1a UTSW 17 56056474 missense unknown
R4303:Chaf1a UTSW 17 56044068 missense unknown
R4577:Chaf1a UTSW 17 56065184 missense probably damaging 1.00
R5254:Chaf1a UTSW 17 56062606 missense probably benign 0.19
R5976:Chaf1a UTSW 17 56064115 missense probably damaging 1.00
R6746:Chaf1a UTSW 17 56063404 missense possibly damaging 0.77
R6799:Chaf1a UTSW 17 56047059 missense unknown
R7327:Chaf1a UTSW 17 56062573 missense probably benign 0.00
R7445:Chaf1a UTSW 17 56062170 missense possibly damaging 0.85
R7565:Chaf1a UTSW 17 56064148 missense probably benign 0.00
R7782:Chaf1a UTSW 17 56062291 missense probably benign 0.02
R7864:Chaf1a UTSW 17 56047339 missense unknown
R8313:Chaf1a UTSW 17 56044109 missense unknown
R9035:Chaf1a UTSW 17 56064110 missense probably damaging 0.98
R9477:Chaf1a UTSW 17 56062244 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCACATGGCATTGCTCAGG -3'
(R):5'- ATACCAGCACATACGGAAGTTGG -3'

Sequencing Primer
(F):5'- GCATTGCTCAGGGCCAC -3'
(R):5'- CTTCTCATAGGCAGAGTTCTCAGAG -3'
Posted On 2016-07-06