Mutagenetix > Incidental Mutation

Incidental Mutation 'R5260:Plekhh2'

401410

Institutional Source

Beutler Lab

Gene Symbol

Plekhh2

Ensembl Gene

ENSMUSG00000040852

Gene Name

pleckstrin homology domain containing, family H (with MyTH4 domain) member 2

Synonyms

MMRRC Submission

042829-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R5260 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84511895-84622142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 84577165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 769 (T769I)

Ref Sequence

ENSEMBL: ENSMUSP00000039628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047206]

AlphaFold

Q8C115

Predicted Effect

probably damaging
Transcript: ENSMUST00000047206
AA Change: T769I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852
AA Change: T769I

Domain	Start	End	E-Value	Type
coiled coil region	19	84	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
coiled coil region	137	174	N/A	INTRINSIC
low complexity region	427	442	N/A	INTRINSIC
low complexity region	579	593	N/A	INTRINSIC
low complexity region	612	651	N/A	INTRINSIC
low complexity region	657	666	N/A	INTRINSIC
PH	703	798	4.7e-19	SMART
PH	811	920	1.15e-4	SMART
MyTH4	954	1109	8.49e-39	SMART
B41	1116	1353	1.01e-27	SMART

Meta Mutation Damage Score

0.5917

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

99% (77/78)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	T	1: 93,159,978	V51E	probably damaging	Het
Abraxas2	A	T	7: 132,859,274	I14F	probably damaging	Het
Acin1	T	C	14: 54,642,822		probably benign	Het
Adamts9	C	A	6: 92,807,137	V1579L	probably benign	Het
Adra2a	T	A	19: 54,046,608	C132S	probably damaging	Het
Aif1	T	A	17: 35,171,941		probably null	Het
Atf5	A	T	7: 44,815,086	Y27*	probably null	Het
Atm	A	G	9: 53,506,611	S799P	probably damaging	Het
Bmp2k	T	G	5: 97,087,351		probably benign	Het
Chaf1a	C	T	17: 56,065,000	H723Y	probably damaging	Het
Clint1	T	C	11: 45,907,942	W493R	probably damaging	Het
Cyb561a3	T	A	19: 10,587,866	V198D	possibly damaging	Het
Cyp2j8	T	C	4: 96,501,064	E174G	possibly damaging	Het
Cyp4v3	C	T	8: 45,306,980	G512S	probably damaging	Het
Dnah8	T	A	17: 30,700,419	V1122D	probably benign	Het
Doc2b	C	A	11: 75,786,163	G128V	probably damaging	Het
Dysf	T	C	6: 84,150,034	V1378A	probably damaging	Het
Efcab5	A	T	11: 77,137,651	S421T	possibly damaging	Het
Efcab6	T	G	15: 83,945,123	D672A	probably benign	Het
Eif2ak3	C	A	6: 70,893,129	H933Q	probably damaging	Het
Erc1	A	T	6: 119,761,159	N574K	probably damaging	Het
Eri2	A	T	7: 119,787,846		probably benign	Het
Faxc	A	G	4: 21,948,744	Y152C	probably damaging	Het
Fbxl7	T	A	15: 26,543,499	Y354F	probably damaging	Het
Fras1	T	A	5: 96,735,187	I2526N	possibly damaging	Het
Gm1966	A	G	7: 106,599,204		noncoding transcript	Het
Gm5424	A	T	10: 62,071,595		noncoding transcript	Het
Gm6728	T	C	6: 136,486,703		noncoding transcript	Het
Golgb1	A	T	16: 36,913,141	S917C	probably benign	Het
Gtpbp3	T	C	8: 71,489,418		probably benign	Het
Gusb	A	T	5: 129,999,988	Y220*	probably null	Het
Hmcn1	A	G	1: 150,595,861	V4914A	possibly damaging	Het
Iars2	C	A	1: 185,323,734	C211F	probably damaging	Het
Kif5b	A	G	18: 6,211,058	L802P	probably damaging	Het
Kif5c	A	G	2: 49,735,590	E624G	probably damaging	Het
Kmt2d	G	T	15: 98,842,860		probably benign	Het
Krt82	C	A	15: 101,548,388	G186C	possibly damaging	Het
Lca5	G	A	9: 83,423,223	R177C	probably damaging	Het
Mier1	T	C	4: 103,162,710	S318P	probably benign	Het
Obscn	A	T	11: 59,003,369	I1207N	probably damaging	Het
Olfr1161	A	C	2: 88,025,474	I251L	probably benign	Het
Olfr1261	A	G	2: 89,994,182	D263G	probably damaging	Het
Olfr1302	A	G	2: 111,781,181	Y287C	probably damaging	Het
Olfr607	A	G	7: 103,460,615	F198L	probably benign	Het
Oog4	C	T	4: 143,437,854	G369D	probably benign	Het
Plec	T	C	15: 76,176,624	T3060A	probably damaging	Het
Prkaa1	A	T	15: 5,160,668	S65C	probably damaging	Het
Psma3	T	C	12: 70,984,642		probably benign	Het
Ptpn18	T	A	1: 34,463,510		probably benign	Het
Ptprv	T	C	1: 135,112,260		noncoding transcript	Het
Rac1	C	A	5: 143,508,131	V104L	probably benign	Het
Serpinb7	A	T	1: 107,434,749	N61I	possibly damaging	Het
Sirt7	A	C	11: 120,620,521		probably benign	Het
Srl	G	A	16: 4,482,895	R333*	probably null	Het
Srprb	A	T	9: 103,201,920	L756Q	probably damaging	Het
Tchhl1	T	C	3: 93,470,795	S269P	probably damaging	Het
Tdo2	C	T	3: 81,975,323		probably null	Het
Teddm1a	T	C	1: 153,891,900	Y37H	probably benign	Het
Tenm3	T	C	8: 48,236,855	Y1899C	probably damaging	Het
Tep1	T	C	14: 50,838,631	T1681A	probably benign	Het
Timm44	G	T	8: 4,275,919		probably null	Het
Trp73	A	G	4: 154,062,602	V322A	possibly damaging	Het
Tsr1	A	C	11: 74,905,955	E611A	probably damaging	Het
Unc80	A	G	1: 66,646,587	N2290S	possibly damaging	Het
Ush2a	T	C	1: 188,947,079	V4828A	possibly damaging	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wnt9b	C	A	11: 103,732,049	S176I	possibly damaging	Het
Zfp329	A	G	7: 12,806,526		probably benign	Het
Zfp352	T	A	4: 90,224,460	V279D	probably damaging	Het
Zfp932	C	T	5: 110,009,635	Q400*	probably null	Het
Zxdc	T	A	6: 90,382,093	L569Q	probably damaging	Het

Other mutations in Plekhh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Plekhh2	APN	17	84521775	missense	probably benign	0.00
IGL00514:Plekhh2	APN	17	84596306	critical splice donor site	probably null
IGL00773:Plekhh2	APN	17	84606868	missense	probably benign	0.01
IGL00985:Plekhh2	APN	17	84563928	missense	probably benign	0.00
IGL01116:Plekhh2	APN	17	84606928	missense	possibly damaging	0.94
IGL01394:Plekhh2	APN	17	84557430	missense	probably benign	0.24
IGL01419:Plekhh2	APN	17	84583552	splice site	probably benign
IGL01932:Plekhh2	APN	17	84577261	missense	probably benign	0.00
IGL02097:Plekhh2	APN	17	84599180	missense	possibly damaging	0.69
IGL02157:Plekhh2	APN	17	84566942	splice site	probably benign
IGL02163:Plekhh2	APN	17	84590795	missense	probably benign	0.45
IGL02237:Plekhh2	APN	17	84575785	missense	probably benign	0.00
IGL02322:Plekhh2	APN	17	84589466	nonsense	probably null
IGL02422:Plekhh2	APN	17	84563809	splice site	probably benign
IGL02483:Plekhh2	APN	17	84596260	missense	possibly damaging	0.81
IGL02493:Plekhh2	APN	17	84606963	critical splice donor site	probably null
IGL03007:Plekhh2	APN	17	84574960	missense	possibly damaging	0.65
R0003:Plekhh2	UTSW	17	84557392	missense	probably damaging	1.00
R0005:Plekhh2	UTSW	17	84586433	missense	probably benign	0.16
R0099:Plekhh2	UTSW	17	84591672	nonsense	probably null
R0331:Plekhh2	UTSW	17	84586366	missense	possibly damaging	0.81
R0883:Plekhh2	UTSW	17	84618031	missense	probably benign	0.11
R1051:Plekhh2	UTSW	17	84521827	critical splice donor site	probably null
R1084:Plekhh2	UTSW	17	84571126	missense	probably damaging	0.99
R1351:Plekhh2	UTSW	17	84577146	splice site	probably benign
R1459:Plekhh2	UTSW	17	84610775	nonsense	probably null
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1510:Plekhh2	UTSW	17	84559576	splice site	probably null
R1699:Plekhh2	UTSW	17	84577184	nonsense	probably null
R1738:Plekhh2	UTSW	17	84566697	missense	possibly damaging	0.67
R1773:Plekhh2	UTSW	17	84599265	missense	probably damaging	1.00
R1796:Plekhh2	UTSW	17	84599133	critical splice acceptor site	probably null
R1823:Plekhh2	UTSW	17	84575189	missense	probably damaging	1.00
R1998:Plekhh2	UTSW	17	84606877	missense	possibly damaging	0.58
R2437:Plekhh2	UTSW	17	84586479	splice site	probably null
R2847:Plekhh2	UTSW	17	84597966	missense	probably damaging	1.00
R4088:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R4227:Plekhh2	UTSW	17	84566795	missense	probably benign	0.00
R4249:Plekhh2	UTSW	17	84586337	missense	possibly damaging	0.93
R4347:Plekhh2	UTSW	17	84619702	missense	probably benign	0.12
R4562:Plekhh2	UTSW	17	84566097	missense	probably benign	0.00
R4649:Plekhh2	UTSW	17	84575263	missense	probably damaging	1.00
R4737:Plekhh2	UTSW	17	84563959	missense	probably benign
R4743:Plekhh2	UTSW	17	84571120	missense	probably damaging	1.00
R4858:Plekhh2	UTSW	17	84600697	missense	probably damaging	1.00
R5036:Plekhh2	UTSW	17	84571761	missense	probably damaging	0.99
R5385:Plekhh2	UTSW	17	84557466	missense	probably benign	0.00
R5409:Plekhh2	UTSW	17	84586478	critical splice donor site	probably null
R5510:Plekhh2	UTSW	17	84566847	missense	probably benign
R5557:Plekhh2	UTSW	17	84560152	missense	probably benign	0.10
R5684:Plekhh2	UTSW	17	84597918	missense	probably damaging	1.00
R5685:Plekhh2	UTSW	17	84569882	missense	probably damaging	1.00
R5724:Plekhh2	UTSW	17	84566805	missense	probably benign	0.00
R5742:Plekhh2	UTSW	17	84597980	missense	probably damaging	1.00
R5817:Plekhh2	UTSW	17	84571726	missense	possibly damaging	0.86
R6218:Plekhh2	UTSW	17	84591564	missense	probably benign	0.03
R6334:Plekhh2	UTSW	17	84566866	missense	probably benign
R6345:Plekhh2	UTSW	17	84575787	missense	probably benign	0.01
R6617:Plekhh2	UTSW	17	84566287	missense	possibly damaging	0.65
R6755:Plekhh2	UTSW	17	84591585	missense	probably damaging	1.00
R6864:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R7171:Plekhh2	UTSW	17	84521788	missense	probably damaging	0.96
R7413:Plekhh2	UTSW	17	84566296	missense	probably benign	0.03
R7585:Plekhh2	UTSW	17	84577180	missense	probably benign	0.11
R7640:Plekhh2	UTSW	17	84610776	missense	possibly damaging	0.50
R7733:Plekhh2	UTSW	17	84583524	nonsense	probably null
R7877:Plekhh2	UTSW	17	84575006	missense	probably benign
R8085:Plekhh2	UTSW	17	84597956	missense	probably damaging	0.98
R8206:Plekhh2	UTSW	17	84590849	missense	possibly damaging	0.47
R8296:Plekhh2	UTSW	17	84600685	missense	probably damaging	0.98
R8344:Plekhh2	UTSW	17	84571761	missense	possibly damaging	0.64
R8438:Plekhh2	UTSW	17	84569951	missense	probably benign
R8487:Plekhh2	UTSW	17	84557481	missense	possibly damaging	0.55
R8708:Plekhh2	UTSW	17	84574993	missense	probably benign	0.00
R8830:Plekhh2	UTSW	17	84521803	missense	probably damaging	1.00
R8847:Plekhh2	UTSW	17	84571051	missense	probably benign	0.00
R8918:Plekhh2	UTSW	17	84599193	missense	possibly damaging	0.80
R9047:Plekhh2	UTSW	17	84590762	missense	probably damaging	0.99
R9404:Plekhh2	UTSW	17	84571040	critical splice acceptor site	probably null
R9428:Plekhh2	UTSW	17	84566413	missense	probably benign
R9516:Plekhh2	UTSW	17	84610812	missense	probably benign	0.00
R9559:Plekhh2	UTSW	17	84591589	missense	probably damaging	1.00
R9589:Plekhh2	UTSW	17	84547490	missense	possibly damaging	0.90
R9641:Plekhh2	UTSW	17	84566702	missense	probably damaging	1.00
R9659:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95
R9788:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGAAGTGTGTCAGACCCACG -3'
(R):5'- CATGATGCATCGCACTCACC -3'

Sequencing Primer
(F):5'- TGTGTCAGACCCACGTGAGAAG -3'
(R):5'- CCAAAGCAGCAGCCTAGGATG -3'

Posted On

2016-07-06