Incidental Mutation 'R5260:Adra2a'
ID 401414
Institutional Source Beutler Lab
Gene Symbol Adra2a
Ensembl Gene ENSMUSG00000033717
Gene Name adrenergic receptor, alpha 2a
Synonyms alpha2A-adrenergic receptor, Adra-2, alpha2A-AR, alpha(2A)AR, alpha2A, Adra-2a
MMRRC Submission 042829-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 54033690-54037413 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54035039 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 132 (C132S)
Ref Sequence ENSEMBL: ENSMUSP00000036203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036700]
AlphaFold Q01338
Predicted Effect probably damaging
Transcript: ENSMUST00000036700
AA Change: C132S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036203
Gene: ENSMUSG00000033717
AA Change: C132S

DomainStartEndE-ValueType
Pfam:7tm_4 55 237 1.5e-7 PFAM
Pfam:7TM_GPCR_Srx 56 188 2.5e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 245 3.7e-7 PFAM
Pfam:7tm_1 65 441 1.5e-73 PFAM
Meta Mutation Damage Score 0.5428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Studies in mouse revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons; the alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes alpha2A subtype and it contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene fail to produce hypotensive responsiveness to alpha2AR agonists, including failure to inhibit voltage-gated Ca2+ currents and spontaneous neuronal firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A T 7: 132,461,003 (GRCm39) I14F probably damaging Het
Acin1 T C 14: 54,880,279 (GRCm39) probably benign Het
Adamts9 C A 6: 92,784,118 (GRCm39) V1579L probably benign Het
Aif1 T A 17: 35,390,917 (GRCm39) probably null Het
Atf5 A T 7: 44,464,510 (GRCm39) Y27* probably null Het
Atm A G 9: 53,417,911 (GRCm39) S799P probably damaging Het
Bmp2k T G 5: 97,235,210 (GRCm39) probably benign Het
Chaf1a C T 17: 56,372,000 (GRCm39) H723Y probably damaging Het
Clint1 T C 11: 45,798,769 (GRCm39) W493R probably damaging Het
Cyb561a3 T A 19: 10,565,230 (GRCm39) V198D possibly damaging Het
Cyp2j8 T C 4: 96,389,301 (GRCm39) E174G possibly damaging Het
Cyp4v3 C T 8: 45,760,017 (GRCm39) G512S probably damaging Het
Dnah8 T A 17: 30,919,393 (GRCm39) V1122D probably benign Het
Doc2b C A 11: 75,676,989 (GRCm39) G128V probably damaging Het
Dysf T C 6: 84,127,016 (GRCm39) V1378A probably damaging Het
Efcab5 A T 11: 77,028,477 (GRCm39) S421T possibly damaging Het
Efcab6 T G 15: 83,829,324 (GRCm39) D672A probably benign Het
Eif2ak3 C A 6: 70,870,113 (GRCm39) H933Q probably damaging Het
Erc1 A T 6: 119,738,120 (GRCm39) N574K probably damaging Het
Eri2 A T 7: 119,387,069 (GRCm39) probably benign Het
Faxc A G 4: 21,948,744 (GRCm39) Y152C probably damaging Het
Fbxl7 T A 15: 26,543,585 (GRCm39) Y354F probably damaging Het
Fras1 T A 5: 96,883,046 (GRCm39) I2526N possibly damaging Het
Gm5424 A T 10: 61,907,374 (GRCm39) noncoding transcript Het
Gm6728 T C 6: 136,463,701 (GRCm39) noncoding transcript Het
Golgb1 A T 16: 36,733,503 (GRCm39) S917C probably benign Het
Gtpbp3 T C 8: 71,942,062 (GRCm39) probably benign Het
Gusb A T 5: 130,028,829 (GRCm39) Y220* probably null Het
Gvin3 A G 7: 106,198,411 (GRCm39) noncoding transcript Het
Hmcn1 A G 1: 150,471,612 (GRCm39) V4914A possibly damaging Het
Iars2 C A 1: 185,055,931 (GRCm39) C211F probably damaging Het
Kif5b A G 18: 6,211,058 (GRCm39) L802P probably damaging Het
Kif5c A G 2: 49,625,602 (GRCm39) E624G probably damaging Het
Kmt2d G T 15: 98,740,741 (GRCm39) probably benign Het
Krt82 C A 15: 101,456,823 (GRCm39) G186C possibly damaging Het
Lca5 G A 9: 83,305,276 (GRCm39) R177C probably damaging Het
Mab21l4 A T 1: 93,087,700 (GRCm39) V51E probably damaging Het
Mier1 T C 4: 103,019,907 (GRCm39) S318P probably benign Het
Obscn A T 11: 58,894,195 (GRCm39) I1207N probably damaging Het
Oog4 C T 4: 143,164,424 (GRCm39) G369D probably benign Het
Or4c126 A G 2: 89,824,526 (GRCm39) D263G probably damaging Het
Or4k52 A G 2: 111,611,526 (GRCm39) Y287C probably damaging Het
Or52d13 A G 7: 103,109,822 (GRCm39) F198L probably benign Het
Or5d35 A C 2: 87,855,818 (GRCm39) I251L probably benign Het
Plec T C 15: 76,060,824 (GRCm39) T3060A probably damaging Het
Plekhh2 C T 17: 84,884,593 (GRCm39) T769I probably damaging Het
Prkaa1 A T 15: 5,190,149 (GRCm39) S65C probably damaging Het
Psma3 T C 12: 71,031,416 (GRCm39) probably benign Het
Ptpn18 T A 1: 34,502,591 (GRCm39) probably benign Het
Ptprv T C 1: 135,039,998 (GRCm39) noncoding transcript Het
Rac1 C A 5: 143,493,886 (GRCm39) V104L probably benign Het
Serpinb7 A T 1: 107,362,479 (GRCm39) N61I possibly damaging Het
Sirt7 A C 11: 120,511,347 (GRCm39) probably benign Het
Srl G A 16: 4,300,759 (GRCm39) R333* probably null Het
Srprb A T 9: 103,079,119 (GRCm39) L756Q probably damaging Het
Tchhl1 T C 3: 93,378,102 (GRCm39) S269P probably damaging Het
Tdo2 C T 3: 81,882,630 (GRCm39) probably null Het
Teddm1a T C 1: 153,767,646 (GRCm39) Y37H probably benign Het
Tenm3 T C 8: 48,689,890 (GRCm39) Y1899C probably damaging Het
Tep1 T C 14: 51,076,088 (GRCm39) T1681A probably benign Het
Timm44 G T 8: 4,325,919 (GRCm39) probably null Het
Trp73 A G 4: 154,147,059 (GRCm39) V322A possibly damaging Het
Tsr1 A C 11: 74,796,781 (GRCm39) E611A probably damaging Het
Unc80 A G 1: 66,685,746 (GRCm39) N2290S possibly damaging Het
Ush2a T C 1: 188,679,276 (GRCm39) V4828A possibly damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnt9b C A 11: 103,622,875 (GRCm39) S176I possibly damaging Het
Zfp329 A G 7: 12,540,453 (GRCm39) probably benign Het
Zfp352 T A 4: 90,112,697 (GRCm39) V279D probably damaging Het
Zfp932 C T 5: 110,157,501 (GRCm39) Q400* probably null Het
Zxdc T A 6: 90,359,075 (GRCm39) L569Q probably damaging Het
Other mutations in Adra2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
splenda UTSW 19 54,034,926 (GRCm39) missense probably damaging 1.00
splenda2 UTSW 19 54,035,070 (GRCm39) missense probably damaging 1.00
R0245:Adra2a UTSW 19 54,035,840 (GRCm39) missense probably damaging 1.00
R1933:Adra2a UTSW 19 54,034,837 (GRCm39) missense probably damaging 1.00
R2175:Adra2a UTSW 19 54,034,793 (GRCm39) missense probably benign 0.04
R4553:Adra2a UTSW 19 54,035,166 (GRCm39) missense possibly damaging 0.86
R4781:Adra2a UTSW 19 54,034,926 (GRCm39) missense probably damaging 1.00
R4984:Adra2a UTSW 19 54,035,070 (GRCm39) missense probably damaging 1.00
R5326:Adra2a UTSW 19 54,035,112 (GRCm39) missense probably damaging 1.00
R5585:Adra2a UTSW 19 54,034,670 (GRCm39) missense probably benign 0.00
R6861:Adra2a UTSW 19 54,034,818 (GRCm39) missense probably damaging 1.00
R7290:Adra2a UTSW 19 54,034,835 (GRCm39) missense probably damaging 1.00
R7677:Adra2a UTSW 19 54,035,375 (GRCm39) missense probably damaging 1.00
R7836:Adra2a UTSW 19 54,034,659 (GRCm39) missense probably benign 0.41
R8997:Adra2a UTSW 19 54,035,729 (GRCm39) missense probably benign 0.04
R9486:Adra2a UTSW 19 54,035,963 (GRCm39) missense probably damaging 1.00
R9544:Adra2a UTSW 19 54,035,454 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CCTGCTCATGCTGTTCACAG -3'
(R):5'- CTTCTCTATGGAGATGAGTGGC -3'

Sequencing Primer
(F):5'- CACAGTATTTGGCAACGTGC -3'
(R):5'- CGGGAAGGAGATGACAGCC -3'
Posted On 2016-07-06