Incidental Mutation 'R5260:Adra2a'
ID 401414
Institutional Source Beutler Lab
Gene Symbol Adra2a
Ensembl Gene ENSMUSG00000033717
Gene Name adrenergic receptor, alpha 2a
Synonyms alpha2A-AR, Adra-2a, Adra-2, alpha2A, alpha2A-adrenergic receptor, alpha(2A)AR
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5260 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 54045182-54048982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54046608 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 132 (C132S)
Ref Sequence ENSEMBL: ENSMUSP00000036203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036700]
AlphaFold Q01338
Predicted Effect probably damaging
Transcript: ENSMUST00000036700
AA Change: C132S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036203
Gene: ENSMUSG00000033717
AA Change: C132S

DomainStartEndE-ValueType
Pfam:7tm_4 55 237 1.5e-7 PFAM
Pfam:7TM_GPCR_Srx 56 188 2.5e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 245 3.7e-7 PFAM
Pfam:7tm_1 65 441 1.5e-73 PFAM
Meta Mutation Damage Score 0.5428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Studies in mouse revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons; the alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes alpha2A subtype and it contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene fail to produce hypotensive responsiveness to alpha2AR agonists, including failure to inhibit voltage-gated Ca2+ currents and spontaneous neuronal firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr1302 A G 2: 111,781,181 Y287C probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Adra2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
splenda UTSW 19 54046495 missense probably damaging 1.00
splenda2 UTSW 19 54046639 missense probably damaging 1.00
R0245:Adra2a UTSW 19 54047409 missense probably damaging 1.00
R1933:Adra2a UTSW 19 54046406 missense probably damaging 1.00
R2175:Adra2a UTSW 19 54046362 missense probably benign 0.04
R4553:Adra2a UTSW 19 54046735 missense possibly damaging 0.86
R4781:Adra2a UTSW 19 54046495 missense probably damaging 1.00
R4984:Adra2a UTSW 19 54046639 missense probably damaging 1.00
R5326:Adra2a UTSW 19 54046681 missense probably damaging 1.00
R5585:Adra2a UTSW 19 54046239 missense probably benign 0.00
R6861:Adra2a UTSW 19 54046387 missense probably damaging 1.00
R7290:Adra2a UTSW 19 54046404 missense probably damaging 1.00
R7677:Adra2a UTSW 19 54046944 missense probably damaging 1.00
R7836:Adra2a UTSW 19 54046228 missense probably benign 0.41
R8997:Adra2a UTSW 19 54047298 missense probably benign 0.04
R9486:Adra2a UTSW 19 54047532 missense probably damaging 1.00
R9544:Adra2a UTSW 19 54047023 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CCTGCTCATGCTGTTCACAG -3'
(R):5'- CTTCTCTATGGAGATGAGTGGC -3'

Sequencing Primer
(F):5'- CACAGTATTTGGCAACGTGC -3'
(R):5'- CGGGAAGGAGATGACAGCC -3'
Posted On 2016-07-06